MirGeneDB

MirGeneDB ID

Lgi-Mir-92-o30

Family name MIR-92 (all species)
Seed AUUGCAC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-92
Paralogues Lgi-Mir-92-o27-v1  Lgi-Mir-92-o27-v2  Lgi-Mir-92-o28  Lgi-Mir-92-o29 
Orthologues Asu-Mir-92  Cel-Mir-92  Isc-Mir-92 
Node of Origin (locus) L. gigantea
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_47: 46552-46607 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o30)
Mir-92-o28 LOTGIsca_47: 43039-43096 [-] Ensembl
Mir-92-o29 LOTGIsca_47: 43249-43304 [-] Ensembl
Mir-92-o27-v1 LOTGIsca_47: 43373-43430 [-] Ensembl
Mir-92-o27-v2 LOTGIsca_47: 43373-43430 [-] Ensembl
Mir-92-o30 LOTGIsca_47: 46552-46607 [-] Ensembl
Mir-190-v1 LOTGIsca_47: 52951-53013 [-] Ensembl
Mir-190-v2 LOTGIsca_47: 52951-53012 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CAAGAUUGGAUUGACAUGAAAUUGCUGGAUGGACUGGAACUUGUGCAAUGCAGAAUUUGAUAUGUAUUGCACUUGUCCCGGCCUUUCUACAAUUUUUAUUCUCCUUUUUCUGUUUU
Get precursor sequence
Structure
        10           20        30         40        50       
CAAGAUUGGAUUGACAU---|      C    U-  A    A  UU          GAAU 
                    GAAAUUG UGGA  GG CUGG AC  GUGCAAUGCA    U
                    UUUUAAC AUCU  CC GGCC UG  CACGUUAUGU    U
UUUUGUCUUUUUCCUCUUAU^      -    UU  -    C  UU          AUAG 
    110       100        90          80        70        60
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Lgi-Mir-92-o30_5p*

MirBase accessionNone
Sequence
0- GGACUGGAACUUGUGCAAUGCA -22
Get sequence
Mature sequence

Lgi-Mir-92-o30_3p

MirBase accessionMIMAT0009574
Sequence
34- UAUUGCACUUGUCCCGGCCUUU -56
Get sequence