MirGeneDB

MirGeneDB ID

Lgi-Mir-190-v1

Family name MIR-190 (all species)
Seed GAUAUGU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-190
Paralogues Lgi-Mir-190-v2 
Orthologues Aae-Mir-190  Asu-Mir-190  Bfl-Mir-190  Bge-Mir-190  Cbr-Mir-190  Cel-Mir-190  Cgi-Mir-190  Cte-Mir-190  Dan-Mir-190  Dme-Mir-190  Dmo-Mir-190  Dpu-Mir-190  Hme-Mir-190  Isc-Mir-190  Pfl-Mir-190  Pmi-Mir-190  Sko-Mir-190  Tca-Mir-190 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_47: 52951-53013 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-190-v1)
Mir-92-o28 LOTGIsca_47: 43039-43096 [-] Ensembl
Mir-92-o29 LOTGIsca_47: 43249-43304 [-] Ensembl
Mir-92-o27-v1 LOTGIsca_47: 43373-43430 [-] Ensembl
Mir-92-o27-v2 LOTGIsca_47: 43373-43430 [-] Ensembl
Mir-92-o30 LOTGIsca_47: 46552-46607 [-] Ensembl
Mir-190-v1 LOTGIsca_47: 52951-53013 [-] Ensembl
Mir-190-v2 LOTGIsca_47: 52951-53012 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAUGUUUGAAGAGUUUGCUGAUCUCUGUUAGAUAUGUUUGAUAUAAUUGGUGGUUAAUGGUUAAAAGUCCACCAAGUAUCAAACAUGUCACUACAGAGGUCUGUCCUUUCACCUACCAAACC
Get precursor sequence
Structure
        10         20        30         40        50        60  
AAAUGUUUGAAGAGUUU-  U         UA-|             AA      GUUAAUGG 
                  GC GAUCUCUGU   GAUAUGUUUGAUAU  UUGGUG        \
                  UG CUGGAGACA   CUGUACAAACUAUG  AACCAC        U
CCAAACCAUCCACUUUCC  U         UCA^             --      CUGAAAAU 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-190-v1_5p

MirBase accessionMIMAT0009586
Sequence
0- AGAUAUGUUUGAUAUAAUUGGUG -23
Get sequence
Star sequence

Lgi-Mir-190-v1_3p* (predicted)

MirBase accessionNone
Sequence
42- CCAAGUAUCAAACAUGUCACU -63
Get sequence