MirGeneDB ID | Mom-Mir-92-o116 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Mossy chiton (Mopalia muscosa) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Mom-Mir-92-o114 Mom-Mir-92-o115 Mom-Mir-92-o117 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | A. granulata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_031763545.1_ASM3176354v1_genomic_Mom) |
JARFOD010081680.1: 3508-3567 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-92-o116) |
Mir-92-o114
JARFOD010081680.1: 722-779 [-]
Ensembl
Mir-92-o117 JARFOD010081680.1: 2925-2980 [-] Ensembl Mir-92-o116 JARFOD010081680.1: 3508-3567 [-] Ensembl Mir-92-o115 JARFOD010081680.1: 3825-3884 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
CAGCCUACAUUCAAAUUAUCUGUCUCCGUUAGGCUUUGACCUGUGCAAUCUUUGUUGUCUUGAAAUCAAAUUGCACUAGUCCCGGCCUGCUGGCGUCAGACAUAAACACAAAAAGUCGUAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 CAGCCUACAUUCAAAUUA--| UCU U UU CU CUUUGUUGU UCUG CCG UAGGCU GAC GUGCAAU C AGAC GGU GUCCGG CUG CACGUUA U AUGCUGAAAAACACAAAUAC^ UGC C CC AU AACUAAAGU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as oMomans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Mom-Mir-92-o116_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGGCUUUGACCUGUGCAAUCUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Mom-Mir-92-o116_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
38- AAUUGCACUAGUCCCGGCCUGC -60
Get sequence
|