MirGeneDB ID | Pau-Mir-92-o124 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Horseshoe worm (Phoronis australis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Pau-Mir-92-o120 Pau-Mir-92-o121 Pau-Mir-92-o122 Pau-Mir-92-o123 Pau-Mir-92-o125 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | P. australis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (Phoronis_australis_GCA_002633005) |
NMRA01000212.1: 607153-607211 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-92-o124) |
Mir-92-o123
NMRA01000212.1: 607025-607083 [+]
Ensembl
Mir-92-o124 NMRA01000212.1: 607153-607211 [+] Ensembl Mir-92-o125 NMRA01000212.1: 607618-607674 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
UACUAAAUGAUCAAUAUGUUUGCUGAGAACAGGUUCGACAUGAGAGCAAUAGUUGAUAUUAUAAUACCAUUGCACUCGUCUCGGUCUGCUCUGAGCAAGCGUUUUCAGCGGUCACAGCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 UACUAAAUGAUCAAUAU--| G A U C A A UGAUA GUUUGCU AGA CAGGU CGA AUGAG GCAAU GU U CGAACGA UCU GUCUG GCU UGCUC CGUUA CA U UCGACACUGGCGACUUUUG^ G C - C A C UAAUA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Pau-Mir-92-o124_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGGUUCGACAUGAGAGCAAUAGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Pau-Mir-92-o124_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
37- CAUUGCACUCGUCUCGGUCUGC -59
Get sequence
|