MirGeneDB

MirGeneDB ID

Bta-Mir-92-P1c

Family name MIR-92 (all species)
Seed AUUGCAC
Species Cow (Bos taurus)
MiRBase ID bta-mir-92b
Paralogues Bta-Mir-92-P1a  Bta-Mir-92-P1b  Bta-Mir-92-P2a  Bta-Mir-92-P2b  Bta-Mir-92-P2c 
Orthologues Ami-Mir-92-P1c  Asu-Mir-92  Bfl-Mir-92-o1  Cel-Mir-92  Cfa-Mir-92-P1c  Cpi-Mir-92-P1c  Cpo-Mir-92-P1c  Dno-Mir-92-P1c  Dre-Mir-92-P1c1  Ete-Mir-92-P1c  Hsa-Mir-92-P1c  Isc-Mir-92  Mdo-Mir-92-P1c  Mml-Mir-92-P1c  Mmu-Mir-92-P1c  Oan-Mir-92-P1c  Ocu-Mir-92-P1c  Rno-Mir-92-P1c  Sha-Mir-92-P1c  Sto-Mir-92-P1c  Tgu-Mir-92-P1c  Xtr-Mir-92-P1c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr3: 15480739-15480801 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGCGGGAUUCCGGGCCCCGGGCGGGCGGGAGGGACGGGACGCGGUGCAGUGUUGUUCUUUCCCCUGCCAAUAUUGCACUCGUCCCGGCCUCCGGCCCCCUCGGCCCCCCGGCCUCCCCCUCA
Get precursor sequence
Structure
        10          20        30        40        50        60  
GAGCGGGAUUCCGGGCC--|    C    G     GA       C           GUUCUUU 
                   CCGGG GGGC GGAGG  CGGGACG GGUGCAGUGUU       \
                   GGCUC CCCG CCUCC  GCCCUGC UCACGUUAUAA       C
ACUCCCCCUCCGGCCCCCC^    C    G     G-       -           CCGUCCC 
 120       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-92-P1c_5p*

MirBase accessionNone
Sequence
0- AGGGACGGGACGCGGUGCAGUGUU -24
Get sequence
Mature sequence

Bta-Mir-92-P1c_3p

MirBase accessionMIMAT0009384
Sequence
41- UAUUGCACUCGUCCCGGCCUCC -63
Get sequence
Validated targets TargetScanVert: bta-miR-92b