MirGeneDB

MirGeneDB ID

Bta-Mir-17-P1c

Family name MIR-17 (all species)
Seed AAAGUGC
Species Cow (Bos taurus)
MiRBase ID bta-mir-93
Paralogues Bta-Mir-17-P1a  Bta-Mir-17-P1b  Bta-Mir-17-P2a  Bta-Mir-17-P2b  Bta-Mir-17-P3a  Bta-Mir-17-P3b  Bta-Mir-17-P3c 
Orthologues Ami-Mir-17-P1c  Cfa-Mir-17-P1c  Cpi-Mir-17-P1c  Cpo-Mir-17-P1c  Dno-Mir-17-P1c  Dre-Mir-17-P1c  Ete-Mir-17-P1c  Hsa-Mir-17-P1c  Mdo-Mir-17-P1c  Mml-Mir-17-P1c  Mmu-Mir-17-P1c  Ocu-Mir-17-P1c  Rno-Mir-17-P1c  Sha-Mir-17-P1c  Xtr-Mir-17-P1c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr25: 36892259-36892320 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P1c)
Mir-17-P3c chr25: 36892057-36892116 [+] UCSC Ensembl
Mir-17-P1c chr25: 36892259-36892320 [+] UCSC Ensembl
Mir-92-P2c chr25: 36892462-36892521 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCACGCCGUGGACCAUCGUCCUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUAGUGUGAUCACCUGACCUACUGCUGAGCCAGCACUUCCCGAGCCCCGGGGACACUACCCCUGCCAGUUGCC
Get precursor sequence
Structure
        10          20        30          40        50        60
UCACGCCGUGGACCAUC--     G       CA-       -|    U    G   UGUGAU 
                   GUCCU GGGGCUC   AAGUGCU GUUCG GCAG UAG      C
                   CAGGG CCCCGAG   UUCACGA CGAGU CGUC AUC      A
CCGUUGACCGUCCCCAUCA     G       CCC       C^    -    -   CAGUCC 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-17-P1c_5p

MirBase accessionMIMAT0003837
Sequence
0- CAAAGUGCUGUUCGUGCAGGUAG -23
Get sequence
Validated targets TargetScanVert: bta-miR-93
Star sequence

Bta-Mir-17-P1c_3p*

MirBase accessionNone
Sequence
39- ACUGCUGAGCCAGCACUUCCCGA -62
Get sequence