MirGeneDB

MirGeneDB ID

Dan-Let-7

Family name LET-7 (all species)
Seed GAGGUAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-let-7
Paralogues
Orthologues Aae-Let-7  Aca-Let-7-P1a  Aca-Let-7-P1b  Aca-Let-7-P1c  Aca-Let-7-P2a1  Aca-Let-7-P2a2  Aca-Let-7-P2a3  Aca-Let-7-P2a4  Aca-Let-7-P2b1  Aca-Let-7-P2b2  Aca-Let-7-P2b3  Aca-Let-7-P2b4  Aca-Let-7-P2c1  Aca-Let-7-P2c2  Aca-Let-7-P2c3  Ami-Let-7-P1a  Ami-Let-7-P1b  Ami-Let-7-P1c  Ami-Let-7-P2a1  Ami-Let-7-P2a2  Ami-Let-7-P2a3  Ami-Let-7-P2a4  Ami-Let-7-P2b1  Ami-Let-7-P2b2  Ami-Let-7-P2b3  Ami-Let-7-P2b4  Ami-Let-7-P2c1  Ami-Let-7-P2c2  Ami-Let-7-P2c3  Asu-Let-7-P5  Asu-Let-7-P7  Bfl-Let-7-P3  Bfl-Let-7-P4  Bge-Let-7  Bta-Let-7-P1a  Bta-Let-7-P1b  Bta-Let-7-P1c  Bta-Let-7-P2a1  Bta-Let-7-P2a2  Bta-Let-7-P2a3  Bta-Let-7-P2b1  Bta-Let-7-P2b2  Bta-Let-7-P2b3  Bta-Let-7-P2c1  Bta-Let-7-P2c2  Bta-Let-7-P2c3  Cbr-Let-7-P5  Cbr-Let-7-P6  Cbr-Let-7-P7  Cbr-Let-7-P8  Cel-Let-7-P5  Cel-Let-7-P6  Cel-Let-7-P7  Cel-Let-7-P8  Cel-Let-7-P9  Cfa-Let-7-P1a  Cfa-Let-7-P1b  Cfa-Let-7-P1c  Cfa-Let-7-P2a1  Cfa-Let-7-P2a2  Cfa-Let-7-P2a3  Cfa-Let-7-P2b1  Cfa-Let-7-P2b2  Cfa-Let-7-P2b3  Cfa-Let-7-P2c1  Cfa-Let-7-P2c3  Cgi-Let-7  Cin-Let-7-P1  Cin-Let-7-P2o1  Cin-Let-7-P2o2  Cin-Let-7-P2o3  Cin-Let-7-P2o4  Cin-Let-7-P2o5  Cli-Let-7-P1a  Cli-Let-7-P1c  Cli-Let-7-P2a1  Cli-Let-7-P2a2  Cli-Let-7-P2a4  Cli-Let-7-P2b1  Cli-Let-7-P2b2  Cli-Let-7-P2b4  Cli-Let-7-P2c1  Cli-Let-7-P2c2  Cli-Let-7-P2c3  Cpi-Let-7-P1a  Cpi-Let-7-P1b  Cpi-Let-7-P1c  Cpi-Let-7-P2a1  Cpi-Let-7-P2a2  Cpi-Let-7-P2a3  Cpi-Let-7-P2a4  Cpi-Let-7-P2b1  Cpi-Let-7-P2b2  Cpi-Let-7-P2b3  Cpi-Let-7-P2b4  Cpi-Let-7-P2c1  Cpi-Let-7-P2c2  Cpi-Let-7-P2c3  Cpo-Let-7-P1a  Cpo-Let-7-P1b  Cpo-Let-7-P1c  Cpo-Let-7-P2a1  Cpo-Let-7-P2a2  Cpo-Let-7-P2a3  Cpo-Let-7-P2b1  Cpo-Let-7-P2b2  Cpo-Let-7-P2b3  Cpo-Let-7-P2c1  Cpo-Let-7-P2c2  Cpo-Let-7-P2c3  Cte-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P1a  Dno-Let-7-P1c  Dno-Let-7-P2a1  Dno-Let-7-P2a2  Dno-Let-7-P2a3  Dno-Let-7-P2b1  Dno-Let-7-P2b2  Dno-Let-7-P2b3  Dno-Let-7-P2c1  Dno-Let-7-P2c2  Dno-Let-7-P2c3  Dpu-Let-7  Dre-Let-7-P1a1  Dre-Let-7-P1a2  Dre-Let-7-P1b1  Dre-Let-7-P1b2  Dre-Let-7-P1c1  Dre-Let-7-P1c2  Dre-Let-7-P2a32  Dre-Let-7-P2a1  Dre-Let-7-P2a2  Dre-Let-7-P2a41  Dre-Let-7-P2a31  Dre-Let-7-P2b1  Dre-Let-7-P2b2  Dre-Let-7-P2b31  Dre-Let-7-P2c2  Dre-Let-7-P2c3  Dre-Let-7-P2b41  Dre-Let-7-P2b42  Efe-Let-7-P10  Efe-Let-7-P11  Efe-Let-7-P12  Efe-Let-7-P13  Efe-Let-7-P14  Ete-Let-7-P1a  Ete-Let-7-P1b  Ete-Let-7-P1c  Ete-Let-7-P2a1  Ete-Let-7-P2a2  Ete-Let-7-P2a3  Ete-Let-7-P2b1  Ete-Let-7-P2b2  Ete-Let-7-P2b3  Ete-Let-7-P2c1  Ete-Let-7-P2c2  Ete-Let-7-P2c3  Gga-Let-7-P1a  Gga-Let-7-P1c  Gga-Let-7-P2a1  Gga-Let-7-P2a2  Gga-Let-7-P2a4  Gga-Let-7-P2b1  Gga-Let-7-P2b2  Gga-Let-7-P2b4  Gga-Let-7-P2c1  Gga-Let-7-P2c2  Gga-Let-7-P2c3  Hme-Let-7  Hsa-Let-7-P1a  Hsa-Let-7-P1b  Hsa-Let-7-P1c  Hsa-Let-7-P2a1  Hsa-Let-7-P2a2  Hsa-Let-7-P2a3  Hsa-Let-7-P2b1  Hsa-Let-7-P2b2  Hsa-Let-7-P2b3  Hsa-Let-7-P2c1  Hsa-Let-7-P2c2  Hsa-Let-7-P2c3  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P1a  Mdo-Let-7-P2a1  Mdo-Let-7-P2a2  Mdo-Let-7-P2a3  Mdo-Let-7-P2b1  Mdo-Let-7-P2b2  Mdo-Let-7-P2c1  Mdo-Let-7-P2c2  Mdo-Let-7-P2c3  Mml-Let-7-P1a  Mml-Let-7-P1b  Mml-Let-7-P1c  Mml-Let-7-P2a1  Mml-Let-7-P2a2  Mml-Let-7-P2a3  Mml-Let-7-P2b1  Mml-Let-7-P2b2  Mml-Let-7-P2b3  Mml-Let-7-P2c1  Mml-Let-7-P2c2  Mml-Let-7-P2c3  Mmu-Let-7-P1a  Mmu-Let-7-P1b  Mmu-Let-7-P1c  Mmu-Let-7-P2a1  Mmu-Let-7-P2a2  Mmu-Let-7-P2a3  Mmu-Let-7-P2b1  Mmu-Let-7-P2b2  Mmu-Let-7-P2b3  Mmu-Let-7-P2c1  Mmu-Let-7-P2c2  Mmu-Let-7-P2c3  Oan-Let-7-P1a  Oan-Let-7-P1b  Oan-Let-7-P1c  Oan-Let-7-P2a1  Oan-Let-7-P2a2  Oan-Let-7-P2a3  Oan-Let-7-P2a4  Oan-Let-7-P2b1  Oan-Let-7-P2b2  Oan-Let-7-P2b3  Oan-Let-7-P2b4  Oan-Let-7-P2c1  Oan-Let-7-P2c2  Oan-Let-7-P2c3  Ocu-Let-7-P1a  Ocu-Let-7-P1c  Ocu-Let-7-P2a1  Ocu-Let-7-P2a2  Ocu-Let-7-P2a3  Ocu-Let-7-P2b1  Ocu-Let-7-P2b2  Ocu-Let-7-P2b3  Ocu-Let-7-P2c1  Ocu-Let-7-P2c2  Ocu-Let-7-P2c3  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P1a  Rno-Let-7-P1b  Rno-Let-7-P1c  Rno-Let-7-P2a1  Rno-Let-7-P2a2  Rno-Let-7-P2a3  Rno-Let-7-P2b1  Rno-Let-7-P2b2  Rno-Let-7-P2b3  Rno-Let-7-P2c1  Rno-Let-7-P2c2  Rno-Let-7-P2c3  Sha-Let-7-P1a  Sha-Let-7-P1b  Sha-Let-7-P1c  Sha-Let-7-P2a1  Sha-Let-7-P2a2  Sha-Let-7-P2a3  Sha-Let-7-P2b1  Sha-Let-7-P2b2  Sha-Let-7-P2c1  Sha-Let-7-P2c2  Sha-Let-7-P2c3  Sko-Let-7  Spu-Let-7  Sto-Let-7-P1a  Sto-Let-7-P1b  Sto-Let-7-P1c  Sto-Let-7-P2a1  Sto-Let-7-P2a2  Sto-Let-7-P2a3  Sto-Let-7-P2b2  Sto-Let-7-P2c1  Sto-Let-7-P2c2  Sto-Let-7-P2c3  Tca-Let-7  Tgu-Let-7-P1a  Tgu-Let-7-P1c3  Tgu-Let-7-P1c4  Tgu-Let-7-P2a1  Tgu-Let-7-P2a2  Tgu-Let-7-P2a4  Tgu-Let-7-P2b1  Tgu-Let-7-P2b2  Tgu-Let-7-P2b4  Tgu-Let-7-P2c32  Tgu-Let-7-P2c1  Tgu-Let-7-P2c2  Tgu-Let-7-P2c31  Xtr-Let-7-P1b  Xtr-Let-7-P1c  Xtr-Let-7-P2a1  Xtr-Let-7-P2a2  Xtr-Let-7-P2a3  Xtr-Let-7-P2b2  Xtr-Let-7-P2b3  Xtr-Let-7-P2c2  Xtr-Let-7-P2c3 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_12916: 2379191-2379250 [+] Ensembl
Clustered MiRNAs
(< 10kb from Let-7)
Mir-10-P2 scaffold_12916: 2378782-2378842 [+] Ensembl
Let-7 scaffold_12916: 2379191-2379250 [+] Ensembl
Mir-10-P3 scaffold_12916: 2379504-2379563 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACACCAAGGACCUUUUUCUCUCUGGCAAAUUGAGGUAGUAGGUUGUAUAGUAGCAACUAAGAAUCGUACUAUACAAUGUGCUAGCUUUCUUUGCUUGACAAUAAGCCGCAUUUGAUUUGA
Get precursor sequence
Structure
        10        20          30        40        50         
ACACCAAGGACCUUUUUCUC--| U      UU   G     G           GCAACU 
                      UC GGCAAA  GAG UAGUA GUUGUAUAGUA      A
                      AG UCGUUU  UUC AUCGU UAACAUAUCAU      A
AGUUUAGUUUACGCCGAAUAAC^ U      CU   G     G           GCUAAG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Let-7_5p

MirBase accessionMIMAT0008467
Sequence
0- UGAGGUAGUAGGUUGUAUAGUA -22
Get sequence
Star sequence

Dan-Let-7_3p*

MirBase accessionNone
Sequence
38- CUAUACAAUGUGCUAGCUUUCU -60
Get sequence