MirGeneDB

MirGeneDB ID

Mmu-Let-7-P2b1

Family name LET-7 (all species)
Seed GAGGUAG
Species House mouse (Mus musculus)
MiRBase ID mmu-let-7f-1
Paralogues Mmu-Let-7-P1a  Mmu-Let-7-P1b  Mmu-Let-7-P1c  Mmu-Let-7-P2a1  Mmu-Let-7-P2a2  Mmu-Let-7-P2a3  Mmu-Let-7-P2b2  Mmu-Let-7-P2b3  Mmu-Let-7-P2c1  Mmu-Let-7-P2c2  Mmu-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P2b1  Ami-Let-7-P2b1  Bge-Let-7  Bta-Let-7-P2b1  Cfa-Let-7-P2b1  Cgi-Let-7  Cli-Let-7-P2b1  Cpi-Let-7-P2b1  Cpo-Let-7-P2b1  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2b1  Dpu-Let-7  Dre-Let-7-P2b1  Ete-Let-7-P2b1  Gga-Let-7-P2b1  Hme-Let-7  Hsa-Let-7-P2b1  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2b1  Mml-Let-7-P2b1  Oan-Let-7-P2b1  Ocu-Let-7-P2b1  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2b1  Sha-Let-7-P2b1  Sko-Let-7  Spu-Let-7  Tca-Let-7  Tgu-Let-7-P2b1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr13: 48537834-48537910 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P2b1)
Let-7-P2c1 chr13: 48536025-48536099 [-] UCSC Ensembl
Let-7-P2b1 chr13: 48537834-48537910 [-] UCSC Ensembl
Let-7-P2a1 chr13: 48538189-48538260 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUUCCAGAAGAAAAACUUGCUCUAUCAGAGUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGAUUUUACCCUGUUUAGGAGAUAACUAUACAAUCUAUUGCCUUCCCUGAGGAGUAGACUUGCUGCAUUGUUUUUA
Get precursor sequence
Structure
        10           20        30        40        50        60        
AUUCCAGAAGAAAAACU---|     A    AGU                     GUGGGGUAGUGAUUU 
                    UGCUCU UCAG   GAGGUAGUAGAUUGUAUAGUU               U
                    AUGAGG AGUC   UUCCGUUAUCUAACAUAUCAA               A
AUUUUUGUUACGUCGUUCAG^     -    CC-                     UAGAGGAUUUGUCCC 
     130       120        110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Let-7-P2b1_5p

MirBase accessionMIMAT0000525
Sequence
0- UGAGGUAGUAGAUUGUAUAGUU -22
Get sequence
Validated targets microrna.org: MIMAT0000525
TargetScanVert: mmu-let-7f-5p
miRDB: MIMAT0000525
Star sequence

Mmu-Let-7-P2b1_3p*

MirBase accessionMIMAT0004623
Sequence
56- CUAUACAAUCUAUUGCCUUCC -77
Get sequence
Validated targets microrna.org: MIMAT0004623
TargetScanVert: mmu-let-7f-1-3p
miRDB: MIMAT0004623