MirGeneDB

MirGeneDB ID

Mmu-Let-7-P2b2

Family name LET-7 (all species)
Seed GAGGUAG
Species House mouse (Mus musculus)
MiRBase ID mmu-let-7b
Paralogues Mmu-Let-7-P1a  Mmu-Let-7-P1b  Mmu-Let-7-P1c  Mmu-Let-7-P2a1  Mmu-Let-7-P2a2  Mmu-Let-7-P2a3  Mmu-Let-7-P2b1  Mmu-Let-7-P2b3  Mmu-Let-7-P2c1  Mmu-Let-7-P2c2  Mmu-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P2b2  Ami-Let-7-P2b2  Bge-Let-7  Bta-Let-7-P2b2  Cfa-Let-7-P2b2  Cgi-Let-7  Cli-Let-7-P2b2  Cpi-Let-7-P2b2  Cpo-Let-7-P2b2  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2b2  Dpu-Let-7  Dre-Let-7-P2b2  Ete-Let-7-P2b2  Gga-Let-7-P2b2  Hme-Let-7  Hsa-Let-7-P2b2  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2b2  Mml-Let-7-P2b2  Oan-Let-7-P2b2  Ocu-Let-7-P2b2  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2b2  Sha-Let-7-P2b2  Sko-Let-7  Spu-Let-7  Sto-Let-7-P2b2  Tca-Let-7  Tgu-Let-7-P2b2  Xtr-Let-7-P2b2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr15: 85707325-85707399 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P2b2)
Let-7-P2a2 chr15: 85706616-85706684 [+] UCSC Ensembl
Let-7-P2b2 chr15: 85707325-85707399 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGCCUCCUCCAGAACACGGACACCGCAGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCCGAAGAUAACUAUACAACCUACUGCCUUCCCUGAGGCGCCCAGGGACACAGCUACAUGGA
Get precursor sequence
Structure
        10          20        30        40        50        60       
GGCCUCCUCCAGAACAC--| ACA  G     U                     UCAGGGCAGUGAUG 
                   GG   CC CAGGG GAGGUAGUAGGUUGUGUGGUU              U
                   CC   GG GUCCC UUCCGUCAUCCAACAUAUCAA              U
AGGUACAUCGACACAGGGA^ CGC  A     -                     UAGAAGCCUCCCCG 
   130       120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Let-7-P2b2_5p

MirBase accessionMIMAT0000522
Sequence
0- UGAGGUAGUAGGUUGUGUGGUU -22
Get sequence
Validated targets microrna.org: MIMAT0000522
TargetScanVert: mmu-let-7b-5p
miRDB: MIMAT0000522
Star sequence

Mmu-Let-7-P2b2_3p*

MirBase accessionMIMAT0004621
Sequence
54- CUAUACAACCUACUGCCUUCC -75
Get sequence
Validated targets microrna.org: MIMAT0004621
TargetScanVert: mmu-let-7b-3p
miRDB: MIMAT0004621