MirGeneDB

MirGeneDB ID

Aca-Let-7-P2b2

Family name LET-7 (all species)
Seed GAGGUAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-let-7b
Paralogues Aca-Let-7-P1a  Aca-Let-7-P1b  Aca-Let-7-P1c  Aca-Let-7-P2a1  Aca-Let-7-P2a2  Aca-Let-7-P2a3  Aca-Let-7-P2a4  Aca-Let-7-P2b1  Aca-Let-7-P2b3  Aca-Let-7-P2b4  Aca-Let-7-P2c1  Aca-Let-7-P2c2  Aca-Let-7-P2c3 
Orthologues Aae-Let-7  Ami-Let-7-P2b2  Bge-Let-7  Bta-Let-7-P2b2  Cfa-Let-7-P2b2  Cgi-Let-7  Cli-Let-7-P2b2  Cpi-Let-7-P2b2  Cpo-Let-7-P2b2  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2b2  Dpu-Let-7  Dre-Let-7-P2b2  Ete-Let-7-P2b2  Gga-Let-7-P2b2  Hme-Let-7  Hsa-Let-7-P2b2  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2b2  Mml-Let-7-P2b2  Mmu-Let-7-P2b2  Oan-Let-7-P2b2  Ocu-Let-7-P2b2  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2b2  Sha-Let-7-P2b2  Sko-Let-7  Spu-Let-7  Sto-Let-7-P2b2  Tca-Let-7  Tgu-Let-7-P2b2  Xtr-Let-7-P2b2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
5: 83532331-83532407 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUAAAGAGUUGUGUUUAGCUCUGGCAAGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGUAGUCAUUUUGCCCCAAUCAGGAGAUAACUAUACAACCUACUGCCUUCCUUGAGGAGCAGCUUUGCAGCGUGCCCAGAA
Get precursor sequence
Structure
        10           20        30        40        50        60        
AAUAAAGAGUUGUGUUUA---|    GG     U                     UCAGGGUAGUCAUUU 
                     GCUCU  CAAGG GAGGUAGUAGGUUGUGUGGUU               U
                     CGAGG  GUUCC UUCCGUCAUCCAACAUAUCAA               G
AAGACCCGUGCGACGUUUCGA^    A-     -                     UAGAGGACUAACCCC 
     130       120        110        100        90        80        70
Deep sequencing
Go to detailed chart
CommentA "T" is genomically encoded at the 3' end of the 3p arm but it is possible that the 3p arm is post-transcriptionally modified given its secondary structure and that all orthologues are clear Group 2 miRNAs.
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Let-7-P2b2_5p

MirBase accessionMIMAT0021694
Sequence
0- UGAGGUAGUAGGUUGUGUGGUU -22
Get sequence
Star sequence

Aca-Let-7-P2b2_3p*

MirBase accessionMIMAT0021695
Sequence
56- CUAUACAACCUACUGCCUUCC -77
Get sequence