MirGeneDB

MirGeneDB ID

Aca-Let-7-P2c1

Family name LET-7 (all species)
Seed GAGGUAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-let-7d
Paralogues Aca-Let-7-P1a  Aca-Let-7-P1b  Aca-Let-7-P1c  Aca-Let-7-P2a1  Aca-Let-7-P2a2  Aca-Let-7-P2a3  Aca-Let-7-P2a4  Aca-Let-7-P2b1  Aca-Let-7-P2b2  Aca-Let-7-P2b3  Aca-Let-7-P2b4  Aca-Let-7-P2c2  Aca-Let-7-P2c3 
Orthologues Aae-Let-7  Ami-Let-7-P2c1  Bge-Let-7  Bta-Let-7-P2c1  Cfa-Let-7-P2c1  Cgi-Let-7  Cli-Let-7-P2c1  Cpi-Let-7-P2c1  Cpo-Let-7-P2c1  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2c1  Dpu-Let-7  Ete-Let-7-P2c1  Gga-Let-7-P2c1  Hme-Let-7  Hsa-Let-7-P2c1  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2c1  Mml-Let-7-P2c1  Mmu-Let-7-P2c1  Oan-Let-7-P2c1  Ocu-Let-7-P2c1  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2c1  Sha-Let-7-P2c1  Sko-Let-7  Spu-Let-7  Sto-Let-7-P2c1  Tca-Let-7  Tgu-Let-7-P2c1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343225.1: 747549-747623 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P2c1)
Let-7-P2c1 GL343225.1: 747549-747623 [-] UCSC Ensembl
Let-7-P2b1 GL343225.1: 748300-748376 [-] UCSC Ensembl
Let-7-P2a1 GL343225.1: 748901-748972 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCUACAGAAGAAAUUGUGGGCUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGUGGUUUUGCCCAAAAGGAGUUAACUAUACAACCUGCUGCCUUUCUUAGGGCUUUAAUAUUACAACAAAAUAAUU
Get precursor sequence
Structure
        10           20        30        40        50        60       
AGCUACAGAAGAAAUUGU---|   U       A              C      UUAGGGCAGUGGUU 
                     GGGC CCUAGGA GAGGUAGUAGGUUG AUAGUU              U
                     UUCG GGAUUCU UUCCGUCGUCCAAC UAUCAA              U
UUAAUAAAACAACAUUAUAAU^   -       -              A      UUGAGGAAAACCCG 
   130       120        110        100        90        80        70
Deep sequencing
Go to detailed chart
CommentThis is a Group 2 in human according to Kim et al. (2017) but because there is a templated 3' U it is not possible according to read data to classify it as such in other taxa although the secondary structure is consistent with this categorization.
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Let-7-P2c1_5p

MirBase accessionMIMAT0021699
Sequence
0- AGAGGUAGUAGGUUGCAUAGUU -22
Get sequence
Star sequence

Aca-Let-7-P2c1_3p*

MirBase accessionMIMAT0021700
Sequence
54- CUAUACAACCUGCUGCCUUUC -75
Get sequence