MirGeneDB

MirGeneDB ID

Aca-Let-7-P2a3

Family name LET-7 (all species)
Seed GAGGUAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-let-7f-1
Paralogues Aca-Let-7-P1a  Aca-Let-7-P1b  Aca-Let-7-P1c  Aca-Let-7-P2a1  Aca-Let-7-P2a2  Aca-Let-7-P2a4  Aca-Let-7-P2b1  Aca-Let-7-P2b2  Aca-Let-7-P2b3  Aca-Let-7-P2b4  Aca-Let-7-P2c1  Aca-Let-7-P2c2  Aca-Let-7-P2c3 
Orthologues Aae-Let-7  Ami-Let-7-P2a3  Bge-Let-7  Bta-Let-7-P2a3  Cfa-Let-7-P2a3  Cgi-Let-7  Cpi-Let-7-P2a3  Cpo-Let-7-P2a3  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2a3  Dpu-Let-7  Ete-Let-7-P2a3  Hme-Let-7  Hsa-Let-7-P2a3  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2a3  Mml-Let-7-P2a3  Mmu-Let-7-P2a3  Oan-Let-7-P2a3  Ocu-Let-7-P2a3  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2a3  Sha-Let-7-P2a3  Sko-Let-7  Spu-Let-7  Sto-Let-7-P2a3  Tca-Let-7  Xtr-Let-7-P2a3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
1: 205026175-205026245 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P2a3)
Let-7-P2b3 1: 205025693-205025770 [-] UCSC Ensembl
Let-7-P2a3 1: 205026175-205026245 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGCAGACGCUGUUCCUGGACCUCCUGGGAUGAGGUAGUAGAUUGUAUAGUUUUAGGGUCAUACCCGGUCUUGGAGAUAACUAUACAAUCUACUGUCUUUCCUAUGGGAACUCCCAAUUCAUCAUACCAAC
Get precursor sequence
Structure
        10        20          30        40        50        60     
AAGCAGACGCUGUUCCUGGAC--|  C     U   GU                UUAGGGUCAUAC 
                       CUC UGGGA GAG  AGUAGAUUGUAUAGUU            C
                       GGG AUCCU UUC  UCAUCUAACAUAUCAA            C
CAACCAUACUACUUAACCCUCAA^  U     -   UG                UAGAGGUUCUGG 
 .       120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Let-7-P2a3_5p

MirBase accessionMIMAT0021703
Sequence
0- UGAGGUAGUAGAUUGUAUAGUU -22
Get sequence
Star sequence

Aca-Let-7-P2a3_3p*

MirBase accessionMIMAT0021704
Sequence
50- CUAUACAAUCUACUGUCUUUC -71
Get sequence