MirGeneDB

MirGeneDB ID

Aca-Let-7-P2b1

Family name LET-7 (all species)
Seed GAGGUAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-let-7f-2
Paralogues Aca-Let-7-P1a  Aca-Let-7-P1b  Aca-Let-7-P1c  Aca-Let-7-P2a1  Aca-Let-7-P2a2  Aca-Let-7-P2a3  Aca-Let-7-P2a4  Aca-Let-7-P2b2  Aca-Let-7-P2b3  Aca-Let-7-P2b4  Aca-Let-7-P2c1  Aca-Let-7-P2c2  Aca-Let-7-P2c3 
Orthologues Aae-Let-7  Ami-Let-7-P2b1  Bge-Let-7  Bta-Let-7-P2b1  Cfa-Let-7-P2b1  Cgi-Let-7  Cli-Let-7-P2b1  Cpi-Let-7-P2b1  Cpo-Let-7-P2b1  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2b1  Dpu-Let-7  Dre-Let-7-P2b1  Ete-Let-7-P2b1  Gga-Let-7-P2b1  Hme-Let-7  Hsa-Let-7-P2b1  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2b1  Mml-Let-7-P2b1  Mmu-Let-7-P2b1  Oan-Let-7-P2b1  Ocu-Let-7-P2b1  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2b1  Sha-Let-7-P2b1  Sko-Let-7  Spu-Let-7  Tca-Let-7  Tgu-Let-7-P2b1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343225.1: 748300-748376 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P2b1)
Let-7-P2c1 GL343225.1: 747549-747623 [-] UCSC Ensembl
Let-7-P2b1 GL343225.1: 748300-748376 [-] UCSC Ensembl
Let-7-P2a1 GL343225.1: 748901-748972 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUUUAUACAUAGAUUUCUCUUUAUCAGGUUGAGGUAGUAGAUUGUAUAGUUGUAGGGCAGUUAUUUUGCCCUCUUCAGGAGAUAACUAUACAAUCUAUUGCCUUCCCUGAGGAGUAACAUUUCUGCAAUAUUCUAC
Get precursor sequence
Structure
        10             20        30        40        50        60        
UGUUUAUACAUAGAUUU-----|   UUA     UU                     GUAGGGCAGUUAUUU 
                      CUCU   UCAGG  GAGGUAGUAGAUUGUAUAGUU               U
                      GAGG   AGUCC  UUCCGUUAUCUAACAUAUCAA               G
CAUCUUAUAACGUCUUUACAAU^   ---     C-                     UAGAGGACUUCUCCC 
     130       120          110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Let-7-P2b1_5p

MirBase accessionMIMAT0021703
Sequence
0- UGAGGUAGUAGAUUGUAUAGUU -22
Get sequence
Star sequence

Aca-Let-7-P2b1_3p*

MirBase accessionMIMAT0021705
Sequence
56- CUAUACAAUCUAUUGCCUUCC -77
Get sequence