MirGeneDB

MirGeneDB ID

Aca-Let-7-P2b4

Family name LET-7 (all species)
Seed GAGGUAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Let-7-P1a  Aca-Let-7-P1b  Aca-Let-7-P1c  Aca-Let-7-P2a1  Aca-Let-7-P2a2  Aca-Let-7-P2a3  Aca-Let-7-P2a4  Aca-Let-7-P2b1  Aca-Let-7-P2b2  Aca-Let-7-P2b3  Aca-Let-7-P2c1  Aca-Let-7-P2c2  Aca-Let-7-P2c3 
Orthologues Aae-Let-7  Ami-Let-7-P2b4  Bge-Let-7  Cgi-Let-7  Cli-Let-7-P2b4  Cpi-Let-7-P2b4  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Gga-Let-7-P2b4  Hme-Let-7  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Oan-Let-7-P2b4  Pfl-Let-7  Pmi-Let-7  Sko-Let-7  Spu-Let-7  Tca-Let-7  Tgu-Let-7-P2b4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
4: 123683315-123683391 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUAUGAAGCCUCUAUCUUGCUUUGUGGAGGUGAGGUAGUAGGUUGUAUAGUUUGUGGGAGGGAUUACAUCCCAUUUCAGGUGAUAACUAUACAGUCUAUUGCCUUCCUUAAGGAGCAACAAAUCUGGCUUAGGAGCA
Get precursor sequence
Structure
        10           20        30        40        50        60        
AUAUGAAGCCUCUAUCU---|     GUG    U          GU         UGUGGGAGGGAUUAC 
                    UGCUUU   GAGG GAGGUAGUAG  UGUAUAGUU               A
                    ACGAGG   UUCC UUCCGUUAUC  ACAUAUCAA               U
ACGAGGAUUCGGUCUAAACA^     AA-    -          UG         UAGUGGACUUUACCC 
     130       120       110         100        90        80        70
Deep sequencing
Go to detailed chart
CommentAlthough all Let-7-P13s have a templated "T" all other vertebrate Let-7-P4 through P14s are Group 2 miRNAs and where studied all 3' terminal "U"s are post-transcriptionally added to the transcript and thus P13 is also considered a Group 2 miRNA.
3' NTU Yes
MotifsUGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Let-7-P2b4_5p

MirBase accessionNone
Sequence
0- UGAGGUAGUAGGUUGUAUAGUU -22
Get sequence
Star sequence

Aca-Let-7-P2b4_3p*

MirBase accessionNone
Sequence
56- CUAUACAGUCUAUUGCCUUCC -77
Get sequence