MirGeneDB

MirGeneDB ID

Aca-Let-7-P2a2

Family name LET-7 (all species)
Seed GAGGUAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Let-7-P1a  Aca-Let-7-P1b  Aca-Let-7-P1c  Aca-Let-7-P2a1  Aca-Let-7-P2a3  Aca-Let-7-P2a4  Aca-Let-7-P2b1  Aca-Let-7-P2b2  Aca-Let-7-P2b3  Aca-Let-7-P2b4  Aca-Let-7-P2c1  Aca-Let-7-P2c2  Aca-Let-7-P2c3 
Orthologues Aae-Let-7  Ami-Let-7-P2a2  Bge-Let-7  Bta-Let-7-P2a2  Cfa-Let-7-P2a2  Cgi-Let-7  Cli-Let-7-P2a2  Cpi-Let-7-P2a2  Cpo-Let-7-P2a2  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2a2  Dpu-Let-7  Dre-Let-7-P2a2  Ete-Let-7-P2a2  Gga-Let-7-P2a2  Hme-Let-7  Hsa-Let-7-P2a2  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2a2  Mml-Let-7-P2a2  Mmu-Let-7-P2a2  Oan-Let-7-P2a2  Ocu-Let-7-P2a2  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2a2  Sha-Let-7-P2a2  Sko-Let-7  Spu-Let-7  Sto-Let-7-P2a2  Tca-Let-7  Tgu-Let-7-P2a2  Xtr-Let-7-P2a2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
5: 83533341-83533411 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAGCAUCAGAAUCAGACUGUCCUUUGGGGUGAGGUAGUAGGUUGUAUAGUUUUAGGGUUCUGCCCUGCCUGUCACAUAACUAUACAAUCUACUGUCUUUCCUGAAGUGGCUGUGAGAGCAACGCAGGACA
Get precursor sequence
Structure
        10         20         30        40        50        60     
UCAGCAUCAGAAUCAGACU-   -|  UG   U   GU                UUAGGGUUCUGC 
                    GUC CUU  GGG GAG  AGUAGGUUGUAUAGUU            C
                    CGG GAA  CCU UUC  UCAUCUAACAUAUCAA            C
ACAGGACGCAACGAGAGUGU   U^  GU   -   UG                UACACUGUCCGU 
 .       120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Let-7-P2a2_5p

MirBase accessionNone
Sequence
0- UGAGGUAGUAGGUUGUAUAGUU -22
Get sequence
Star sequence

Aca-Let-7-P2a2_3p*

MirBase accessionNone
Sequence
50- CUAUACAAUCUACUGUCUUUC -71
Get sequence