MirGeneDB

MirGeneDB ID

Sto-Let-7-P2a2

Family name LET-7 (all species)
Seed GAGGUAG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Let-7-P1a  Sto-Let-7-P1b  Sto-Let-7-P1c  Sto-Let-7-P2a1  Sto-Let-7-P2a3  Sto-Let-7-P2b2  Sto-Let-7-P2c1  Sto-Let-7-P2c2  Sto-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P2a2  Ami-Let-7-P2a2  Bge-Let-7  Bta-Let-7-P2a2  Cfa-Let-7-P2a2  Cgi-Let-7  Cli-Let-7-P2a2  Cpi-Let-7-P2a2  Cpo-Let-7-P2a2  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2a2  Dpu-Let-7  Dre-Let-7-P2a2  Ete-Let-7-P2a2  Gga-Let-7-P2a2  Hme-Let-7  Hsa-Let-7-P2a2  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2a2  Mml-Let-7-P2a2  Mmu-Let-7-P2a2  Oan-Let-7-P2a2  Ocu-Let-7-P2a2  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2a2  Sha-Let-7-P2a2  Sko-Let-7  Spu-Let-7  Tca-Let-7  Tgu-Let-7-P2a2  Xtr-Let-7-P2a2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01007036.1: 67103-67173 [-]
Precursor
(pre-Mir +30nt flank)
GUUGCAGCAGAAUAUUACUGCCCUUUGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUUACACCCUUCCGGUCAGAUAACUAUACAAUCUACUGUCUUUCCUGAGGUGGCUGUCUAAACUGCGGUGGAUC
Get precursor sequence
Structure
        10         20         30        40        50        60     
GUUGCAGCAGAAUAUUACU-   -|  UG   U   GU                UUAGGGUUACAC 
                    GCC CUU  GGA GAG  AGUAGGUUGUAUAGUU            C
                    CGG GGA  CCU UUC  UCAUCUAACAUAUCAA            C
CUAGGUGGCGUCAAAUCUGU   U^  GU   -   UG                UAGACUGGCCUU 
 .       120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Let-7-P2a2_5p

MirBase accessionNone
Sequence
0- UGAGGUAGUAGGUUGUAUAGUU -22
Get sequence
Star sequence

Sto-Let-7-P2a2_3p*

MirBase accessionNone
Sequence
50- CUAUACAAUCUACUGUCUUUC -71
Get sequence