MirGeneDB

MirGeneDB ID

Sto-Let-7-P2c1

Family name LET-7 (all species)
Seed GAGGUAG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Let-7-P1a  Sto-Let-7-P1b  Sto-Let-7-P1c  Sto-Let-7-P2a1  Sto-Let-7-P2a2  Sto-Let-7-P2a3  Sto-Let-7-P2b2  Sto-Let-7-P2c2  Sto-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P2c1  Ami-Let-7-P2c1  Bge-Let-7  Bta-Let-7-P2c1  Cfa-Let-7-P2c1  Cgi-Let-7  Cli-Let-7-P2c1  Cpi-Let-7-P2c1  Cpo-Let-7-P2c1  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2c1  Dpu-Let-7  Ete-Let-7-P2c1  Gga-Let-7-P2c1  Hme-Let-7  Hsa-Let-7-P2c1  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2c1  Mml-Let-7-P2c1  Mmu-Let-7-P2c1  Oan-Let-7-P2c1  Ocu-Let-7-P2c1  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2c1  Sha-Let-7-P2c1  Sko-Let-7  Spu-Let-7  Tca-Let-7  Tgu-Let-7-P2c1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01002606.1: 66711-66785 [+]
Precursor
(pre-Mir +30nt flank)
CAAUGUGGAGAAUAUAGUGAGCUCCUGGGUAGAGGUAGUAGGUUGCAUAGUUCGAGGACUGAAAUUUUGGCCCAAAGGAGAUAACUAUACAACUUGCUGCCUUUCCUAGGGCAUCAUACUGAACAUCACAACUGG
Get precursor sequence
Structure
        10          20         30        40        50        60       
CAAUGUGGAGAAUAUAG--   -| U      U               C      CGAGGACUGAAAUU 
                   UGA GC CCUGGG AGAGGUAGUAGGUUG AUAGUU              U
                   ACU CG GGAUCC UUUCCGUCGUUCAAC UAUCAA              U
GGUCAACACUACAAGUCAU   A^ -      -               A      UAGAGGAAACCCGG 
   130       120        110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Let-7-P2c1_5p

MirBase accessionNone
Sequence
0- AGAGGUAGUAGGUUGCAUAGUU -22
Get sequence
Star sequence

Sto-Let-7-P2c1_3p*

MirBase accessionNone
Sequence
54- CUAUACAACUUGCUGCCUUUC -75
Get sequence