MirGeneDB

MirGeneDB ID

Rno-Let-7-P2c1

Family name LET-7 (all species)
Seed GAGGUAG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-let-7d
Paralogues Rno-Let-7-P1a  Rno-Let-7-P1b  Rno-Let-7-P1c  Rno-Let-7-P2a1  Rno-Let-7-P2a2  Rno-Let-7-P2a3  Rno-Let-7-P2b1  Rno-Let-7-P2b2  Rno-Let-7-P2b3  Rno-Let-7-P2c2  Rno-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P2c1  Ami-Let-7-P2c1  Bge-Let-7  Bta-Let-7-P2c1  Cfa-Let-7-P2c1  Cgi-Let-7  Cli-Let-7-P2c1  Cpi-Let-7-P2c1  Cpo-Let-7-P2c1  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2c1  Dpu-Let-7  Ete-Let-7-P2c1  Gga-Let-7-P2c1  Hme-Let-7  Hsa-Let-7-P2c1  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2c1  Mml-Let-7-P2c1  Mmu-Let-7-P2c1  Oan-Let-7-P2c1  Ocu-Let-7-P2c1  Pfl-Let-7  Pmi-Let-7  Sha-Let-7-P2c1  Sko-Let-7  Spu-Let-7  Sto-Let-7-P2c1  Tca-Let-7  Tgu-Let-7-P2c1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr17: 16419993-16420067 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P2c1)
Let-7-P2a1 chr17: 16417865-16417936 [+] UCSC Ensembl
Let-7-P2b1 chr17: 16418228-16418304 [+] UCSC Ensembl
Let-7-P2c1 chr17: 16419993-16420067 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACCAGCAAGAAUACAGUGGGCUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGAGAUUUUGCCCACAAGGAGUUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUUAUCAUACCAGCAUACAGUUC
Get precursor sequence
Structure
        10           20        30        40        50        60       
GACCAGCAAGAAUACAGU---|   U       A              C      UUAGGGCAGAGAUU 
                     GGGC CCUAGGA GAGGUAGUAGGUUG AUAGUU              U
                     UCCG GGAUUCU UUCCGUCGUCCAGC UAUCAA              U
CUUGACAUACGACCAUACUAU^   -       -              A      UUGAGGAACACCCG 
   130       120        110        100        90        80        70
Deep sequencing
Go to detailed chart
CommentThis is a Group 2 in human according to Kim et al. (2017) but because there is a templated 3' U it is not possible according to read data to classify it as such in other taxa although the secondary structure is consistent with this categorization.
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Let-7-P2c1_5p

MirBase accessionMIMAT0000562
Sequence
0- AGAGGUAGUAGGUUGCAUAGUU -22
Get sequence
Validated targets microrna.org: MIMAT0000562
TargetScanVert: rno-let-7d-5p
miRDB: MIMAT0000562
Star sequence

Rno-Let-7-P2c1_3p*

MirBase accessionMIMAT0000563
Sequence
54- CUAUACGACCUGCUGCCUUUC -75
Get sequence
Validated targets microrna.org: MIMAT0000563
TargetScanVert: rno-let-7d-3p
miRDB: MIMAT0000563