MirGeneDB

MirGeneDB ID

Rno-Let-7-P1b

Family name LET-7 (all species)
Seed GAGGUAG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-let-7e
Paralogues Rno-Let-7-P1a  Rno-Let-7-P1c  Rno-Let-7-P2a1  Rno-Let-7-P2a2  Rno-Let-7-P2a3  Rno-Let-7-P2b1  Rno-Let-7-P2b2  Rno-Let-7-P2b3  Rno-Let-7-P2c1  Rno-Let-7-P2c2  Rno-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P1b  Ami-Let-7-P1b  Bge-Let-7  Bta-Let-7-P1b  Cfa-Let-7-P1b  Cgi-Let-7  Cin-Let-7-P1  Cpi-Let-7-P1b  Cpo-Let-7-P1b  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Dre-Let-7-P1b1  Dre-Let-7-P1b2  Ete-Let-7-P1b  Hme-Let-7  Hsa-Let-7-P1b  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mml-Let-7-P1b  Mmu-Let-7-P1b  Oan-Let-7-P1b  Pfl-Let-7  Pmi-Let-7  Sha-Let-7-P1b  Sko-Let-7  Spu-Let-7  Sto-Let-7-P1b  Tca-Let-7  Xtr-Let-7-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr1: 59704395-59704461 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P1b)
Mir-10-P2b chr1: 59704222-59704281 [+] UCSC Ensembl
Let-7-P1b chr1: 59704395-59704461 [+] UCSC Ensembl
Mir-10-P3b chr1: 59704841-59704900 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAAUCUGCCCACCUGCCGCGCCCCCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAAGACACCCGAGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGGCUGCGCCCUGCACUGGAAGGGGCCG
Get precursor sequence
Structure
        10          20        30        40        50        60   
CAAUCUGCCCACCUGCC--|   CC  C   CU   G                UGAGGAAGACA 
                   GCGC  CC GGG  GAG UAGGAGGUUGUAUAGU           \
                   CGCG  GG CCC  UUC AUCCUCCGGCAUAUCA           C
GCCGGGGAAGGUCACGUCC^   UC  A   CU   G                CUAGAGGAGCC 
     120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Let-7-P1b_5p

MirBase accessionMIMAT0000777
Sequence
0- UGAGGUAGGAGGUUGUAUAGUU -22
Get sequence
Validated targets microrna.org: MIMAT0000777
TargetScanVert: rno-let-7e-5p
miRDB: MIMAT0000777
Star sequence

Rno-Let-7-P1b_3p*

MirBase accessionMIMAT0004706
Sequence
45- CUAUACGGCCUCCUAGCUUUCC -67
Get sequence
Validated targets microrna.org: MIMAT0004706
TargetScanVert: rno-let-7e-3p
miRDB: MIMAT0004706