MirGeneDB

MirGeneDB ID

Hsa-Let-7-P1b

Family name LET-7 (all species)
Seed GAGGUAG
Species Human (Homo sapiens)
MiRBase ID hsa-let-7e
Paralogues Hsa-Let-7-P1a  Hsa-Let-7-P1c  Hsa-Let-7-P2a1  Hsa-Let-7-P2a2  Hsa-Let-7-P2a3  Hsa-Let-7-P2b1  Hsa-Let-7-P2b2  Hsa-Let-7-P2b3  Hsa-Let-7-P2c1  Hsa-Let-7-P2c2  Hsa-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P1b  Ami-Let-7-P1b  Bge-Let-7  Bta-Let-7-P1b  Cfa-Let-7-P1b  Cgi-Let-7  Cin-Let-7-P1  Cpi-Let-7-P1b  Cpo-Let-7-P1b  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Dre-Let-7-P1b1  Dre-Let-7-P1b2  Ete-Let-7-P1b  Hme-Let-7  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mml-Let-7-P1b  Mmu-Let-7-P1b  Oan-Let-7-P1b  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P1b  Sha-Let-7-P1b  Sko-Let-7  Spu-Let-7  Sto-Let-7-P1b  Tca-Let-7  Xtr-Let-7-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(hg38)
chr19: 51692793-51692859 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P1b)
Mir-10-P2b chr19: 51692618-51692677 [+] UCSC Ensembl
Let-7-P1b chr19: 51692793-51692859 [+] UCSC Ensembl
Mir-10-P3b chr19: 51693268-51693327 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGUCUGUCCACCUGCCGCGCCCCCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCAAGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGGCUGCGCCCUGCACGGGACGGGGCCC
Get precursor sequence
Structure
        10          20        30        40        50        60   
GGGUCUGUCCACCUGCC--|   CC  C   CU   G                UGAGGAGGACA 
                   GCGC  CC GGG  GAG UAGGAGGUUGUAUAGU           \
                   CGCG  GG CCC  UUC AUCCUCCGGCAUAUCA           C
CCCGGGGCAGGGCACGUCC^   UC  A   CU   G                CUAGAGGAACC 
     120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Let-7-P1b_5p

MirBase accessionMIMAT0000066
Sequence
0- UGAGGUAGGAGGUUGUAUAGUU -22
Get sequence
Validated targets microrna.org: MIMAT0000066
TargetScanVert: hsa-let-7e-5p
TargetMiner: hsa-let-7e-5p
miRDB: MIMAT0000066
Star sequence

Hsa-Let-7-P1b_3p*

MirBase accessionMIMAT0004485
Sequence
45- CUAUACGGCCUCCUAGCUUUCC -67
Get sequence
Validated targets microrna.org: MIMAT0004485
TargetScanVert: hsa-let-7e-3p
TargetMiner: hsa-let-7e-3p
miRDB: MIMAT0004485