MirGeneDB

MirGeneDB ID

Hsa-Let-7-P2c2

Family name LET-7 (all species)
Seed GAGGUAG
Species Human (Homo sapiens)
MiRBase ID hsa-let-7i
Paralogues Hsa-Let-7-P1a  Hsa-Let-7-P1b  Hsa-Let-7-P1c  Hsa-Let-7-P2a1  Hsa-Let-7-P2a2  Hsa-Let-7-P2a3  Hsa-Let-7-P2b1  Hsa-Let-7-P2b2  Hsa-Let-7-P2b3  Hsa-Let-7-P2c1  Hsa-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P2c2  Ami-Let-7-P2c2  Bge-Let-7  Bta-Let-7-P2c2  Cgi-Let-7  Cli-Let-7-P2c2  Cpi-Let-7-P2c2  Cpo-Let-7-P2c2  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2c2  Dpu-Let-7  Dre-Let-7-P2c2  Ete-Let-7-P2c2  Gga-Let-7-P2c2  Hme-Let-7  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2c2  Mml-Let-7-P2c2  Mmu-Let-7-P2c2  Oan-Let-7-P2c2  Ocu-Let-7-P2c2  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2c2  Sha-Let-7-P2c2  Sko-Let-7  Spu-Let-7  Sto-Let-7-P2c2  Tca-Let-7  Tgu-Let-7-P2c2  Xtr-Let-7-P2c2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(hg38)
chr12: 62603691-62603767 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCGUGCCUCCCCGACACCAUGGCCCUGGCUGAGGUAGUAGUUUGUGCUGUUGGUCGGGUUGUGACAUUGCCCGCUGUGGAGAUAACUGCGCAAGCUACUGCCUUGCUAGUGCUGGUGAUGCUCAGCGCCGCGGAGG
Get precursor sequence
Structure
        10            20        30        40        50        60        
CCCGUGCCUCCCCGACA----|  UG  C     U                 U   GGUCGGGUUGUGACA 
                     CCA  GC CUGGC GAGGUAGUAGUUUGUGC GUU               U
                     GGU  CG GAUCG UUCCGUCAUCGAACGCG CAA               U
GGAGGCGCCGCGACUCGUAGU^  --  U     -                 U   UAGAGGUGUCGCCCG 
     130       120         110        100        90        80        70
Deep sequencing
Go to detailed chart
CommentAlthough there is a templated T at the 3' end of the 3p arm, the post-transcriptional addition of a terminal 3' U is supported by the CAGE data from de Rie et al. (2017). All other vertebrates are treated accordingly.
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Let-7-P2c2_5p

MirBase accessionMIMAT0000415
Sequence
0- UGAGGUAGUAGUUUGUGCUGUU -22
Get sequence
Validated targets microrna.org: MIMAT0000415
TargetScanVert: hsa-let-7i-5p
TargetMiner: hsa-let-7i-5p
miRDB: MIMAT0000415
Star sequence

Hsa-Let-7-P2c2_3p*

MirBase accessionMIMAT0004585
Sequence
56- CUGCGCAAGCUACUGCCUUGC -77
Get sequence
Validated targets microrna.org: MIMAT0004585
TargetScanVert: hsa-let-7i-3p
TargetMiner: hsa-let-7i-3p
miRDB: MIMAT0004585