MirGeneDB

MirGeneDB ID

Xtr-Let-7-P1b

Family name LET-7 (all species)
Seed GAGGUAG
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-let-7a
Paralogues Xtr-Let-7-P1c  Xtr-Let-7-P2a1  Xtr-Let-7-P2a2  Xtr-Let-7-P2a3  Xtr-Let-7-P2b2  Xtr-Let-7-P2b3  Xtr-Let-7-P2c2  Xtr-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P1b  Ami-Let-7-P1b  Bge-Let-7  Bta-Let-7-P1b  Cfa-Let-7-P1b  Cgi-Let-7  Cin-Let-7-P1  Cpi-Let-7-P1b  Cpo-Let-7-P1b  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Dre-Let-7-P1b1  Dre-Let-7-P1b2  Ete-Let-7-P1b  Hme-Let-7  Hsa-Let-7-P1b  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mml-Let-7-P1b  Mmu-Let-7-P1b  Oan-Let-7-P1b  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P1b  Sha-Let-7-P1b  Sko-Let-7  Spu-Let-7  Sto-Let-7-P1b  Tca-Let-7 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(xenTro7)
KB021657: 117274172-117274238 [+] UCSC
Clustered MiRNAs
(< 10kb from Let-7-P1b)
Mir-10-P2b KB021657: 117271316-117271373 [+] UCSC
Let-7-P1b KB021657: 117274172-117274238 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CUGGCUUCUUCUGCUCGGUGGGCUCCAGGCUGAGGUAGUAGGUUGUAUAGUUGAGGAUAACACCAAAGGAGAUAACUGUACAGCCUCCUAUCUUUCCCUGGGGCUUUGCCAUAACAACAAAGCCUCU
Get precursor sequence
Structure
        10         20         30        40        50        60   
CUGGCUUCUUCUGCUCG- UG -|       CU       U             GAGGAUAACA 
                  G  G GCUCCAGG  GAGGUAG AGGUUGUAUAGUU          \
                  C  U CGGGGUCC  UUCUAUC UCCGACAUGUCAA          C
UCUCCGAAACAACAAUAC GU U^       CU       C             UAGAGGAAAC 
     120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Em Em Em Em He
Mature sequence

Xtr-Let-7-P1b_5p

MirBase accessionMIMAT0003667
Sequence
0- UGAGGUAGUAGGUUGUAUAGUU -22
Get sequence
Validated targets TargetScanVert: xtr-let-7a
Star sequence

Xtr-Let-7-P1b_3p*

MirBase accessionNone
Sequence
45- CUGUACAGCCUCCUAUCUUUCC -67
Get sequence