MirGeneDB

MirGeneDB ID

Aca-Let-7-P1b

Family name LET-7 (all species)
Seed GAGGUAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-let-7c-2
Paralogues Aca-Let-7-P1a  Aca-Let-7-P1c  Aca-Let-7-P2a1  Aca-Let-7-P2a2  Aca-Let-7-P2a3  Aca-Let-7-P2a4  Aca-Let-7-P2b1  Aca-Let-7-P2b2  Aca-Let-7-P2b3  Aca-Let-7-P2b4  Aca-Let-7-P2c1  Aca-Let-7-P2c2  Aca-Let-7-P2c3 
Orthologues Aae-Let-7  Ami-Let-7-P1b  Bge-Let-7  Bta-Let-7-P1b  Cfa-Let-7-P1b  Cgi-Let-7  Cin-Let-7-P1  Cpi-Let-7-P1b  Cpo-Let-7-P1b  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Dre-Let-7-P1b1  Dre-Let-7-P1b2  Ete-Let-7-P1b  Hme-Let-7  Hsa-Let-7-P1b  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mml-Let-7-P1b  Mmu-Let-7-P1b  Oan-Let-7-P1b  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P1b  Sha-Let-7-P1b  Sko-Let-7  Spu-Let-7  Sto-Let-7-P1b  Tca-Let-7  Xtr-Let-7-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343604.1: 264168-264235 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P1b)
Mir-10-P2b GL343604.1: 262460-262519 [+] UCSC Ensembl
Let-7-P1b GL343604.1: 264168-264235 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUUCUCCAGAUCUCCGGCGUGCCUCGAGUUGAGGUAGUAGGUUGUAUGGUUUAGAAUAACACCAUCAGGAGAUAACUGUACAGCCUCCUAGCUUUCCCCGGGGCAACGCCACAGUAUGAGAGAGAGA
Get precursor sequence
Structure
        10         20         30        40        50        60   
CCUUCUCCAGAUCUCCG-   -|      AGUU   G   U             UAGAAUAACA 
                  GCG UGCCUCG    GAG UAG AGGUUGUAUGGUU          C
                  CGC ACGGGGC    UUC AUC UCCGACAUGUCAA          C
AGAGAGAGAGUAUGACAC   A^      CCCU   G   C             UAGAGGACUA 
      120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Let-7-P1b_5p

MirBase accessionMIMAT0021696
Sequence
0- UGAGGUAGUAGGUUGUAUGGUU -22
Get sequence
Star sequence

Aca-Let-7-P1b_3p*

MirBase accessionMIMAT0021698
Sequence
46- CUGUACAGCCUCCUAGCUUUCC -68
Get sequence