MirGeneDB

MirGeneDB ID

Aca-Mir-10-P3b

Family name MIR-10 (all species)
Seed CCCUGAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-125a
Paralogues Aca-Mir-10-P1a-v1  Aca-Mir-10-P1a-v2  Aca-Mir-10-P1b-v1  Aca-Mir-10-P1b-v2  Aca-Mir-10-P1c-v1  Aca-Mir-10-P1c-v2  Aca-Mir-10-P2a  Aca-Mir-10-P2b  Aca-Mir-10-P2c  Aca-Mir-10-P3a  Aca-Mir-10-P3c 
Orthologues Aae-Mir-10-P3  Ami-Mir-10-P3b  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Bta-Mir-10-P3b  Cfa-Mir-10-P3b  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cpi-Mir-10-P3b  Cpo-Mir-10-P3b  Cte-Mir-10-P3  Dan-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dpu-Mir-10-P3  Dre-Mir-10-P3b1  Dre-Mir-10-P3b2  Ete-Mir-10-P3b  Hsa-Mir-10-P3b  Isc-Mir-10-P3  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mml-Mir-10-P3b  Mmu-Mir-10-P3b  Oan-Mir-10-P3b  Ocu-Mir-10-P3b  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Rno-Mir-10-P3b  Sha-Mir-10-P3b  Sko-Mir-10-P3  Spu-Mir-10-P3  Sto-Mir-10-P3b  Tca-Mir-10-P3  Xtr-Mir-10-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(anoCar2)
GL343604.1: 274397-274456 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGUUUCCUUACUUUCGGGCAUCUUCUCUGUCCCUGAGACCCUUAACCUGUGAGGAAGCCCAGAGGUCACAGGUGAGGUUCUUGGGAACUGAGCGGAGAGCCACCCCACGGACCCCACGG
Get precursor sequence
Structure
        10         20         30        40        50          
UUGUUUCCUUACUUUCG-   A-|  U   U  C  UG   C     A       GGAAGC 
                  GGC  UCU CUC GU CC  AGA CCUUA CCUGUGA      \
                  CCG  AGG GAG CA GG  UCU GGAGU GGACACU      C
GGCACCCCAGGCACCCCA   AG^  C   U  A  GU   U     -       GGAGAC 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-10-P3b_5p

MirBase accessionMIMAT0021727
Sequence
0- UCCCUGAGACCCUUAACCUGUGA -23
Get sequence
Star sequence

Aca-Mir-10-P3b_3p*

MirBase accessionMIMAT0021728
Sequence
38- ACAGGUGAGGUUCUUGGGAACU -60
Get sequence