MirGeneDB

MirGeneDB ID

Cte-Mir-10-P3

Family name MIR-10 (all species)
Seed CCCUGAG
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-mir-125
Paralogues Cte-Mir-10-P1  Cte-Mir-10-P2  Cte-Mir-10-P4  Cte-Mir-10-P5  Cte-Mir-10-P6  Cte-Mir-10-P7 
Orthologues Aae-Mir-10-P3  Aca-Mir-10-P3a  Aca-Mir-10-P3b  Aca-Mir-10-P3c  Ami-Mir-10-P3a  Ami-Mir-10-P3b  Ami-Mir-10-P3c  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Bta-Mir-10-P3a  Bta-Mir-10-P3b  Bta-Mir-10-P3c  Cbr-Mir-10-P3e  Cbr-Mir-10-P3f  Cel-Mir-10-P3e  Cel-Mir-10-P3f  Cfa-Mir-10-P3a  Cfa-Mir-10-P3b  Cfa-Mir-10-P3c  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cli-Mir-10-P3a  Cli-Mir-10-P3c  Cpi-Mir-10-P3a  Cpi-Mir-10-P3b  Cpi-Mir-10-P3c  Cpo-Mir-10-P3a  Cpo-Mir-10-P3b  Cpo-Mir-10-P3c  Dan-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dno-Mir-10-P3a  Dno-Mir-10-P3c  Dpu-Mir-10-P3  Dre-Mir-10-P3a1  Dre-Mir-10-P3a2  Dre-Mir-10-P3b1  Dre-Mir-10-P3b2  Dre-Mir-10-P3c1  Dre-Mir-10-P3c2  Efe-Mir-10-P3g  Efe-Mir-10-P3h  Efe-Mir-10-P3i  Ete-Mir-10-P3a  Ete-Mir-10-P3b  Ete-Mir-10-P3c  Gga-Mir-10-P3a  Gga-Mir-10-P3c  Hsa-Mir-10-P3a  Hsa-Mir-10-P3b  Hsa-Mir-10-P3c  Isc-Mir-10-P3  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mdo-Mir-10-P3a  Mdo-Mir-10-P3c  Mml-Mir-10-P3a  Mml-Mir-10-P3b  Mml-Mir-10-P3c  Mmu-Mir-10-P3a  Mmu-Mir-10-P3b  Mmu-Mir-10-P3c  Oan-Mir-10-P3a  Oan-Mir-10-P3b  Oan-Mir-10-P3c  Ocu-Mir-10-P3a  Ocu-Mir-10-P3b  Ocu-Mir-10-P3c  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Rno-Mir-10-P3a  Rno-Mir-10-P3b  Rno-Mir-10-P3c  Sha-Mir-10-P3a  Sha-Mir-10-P3b  Sha-Mir-10-P3c  Sko-Mir-10-P3  Spu-Mir-10-P3  Sto-Mir-10-P3a  Sto-Mir-10-P3b  Sto-Mir-10-P3c  Tca-Mir-10-P3  Tgu-Mir-10-P3a  Tgu-Mir-10-P3c  Xtr-Mir-10-P3a  Xtr-Mir-10-P3b  Xtr-Mir-10-P3c 
Node of Origin (locus) Bilateria
Node of Origin (family) Eumetazoa
Genome context
(Capitella_teleta_v1.0)
CAPTEscaffold_135: 290568-290628 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCUGACCACUAACCACUCGGCAUCUCGCACUCCCUGAGACCCUAACUUGUGAAGCUUUCUAAAAAGAUCGCGAGUUAGAAUCUUGGGCUCUGCGAGGAGCUCGAUUGCCGUCGAAUGAAGA
Get precursor sequence
Structure
        10          20        30        40        50          
GCUGACCACUAACCACU-  -| AU      CUC  UG   CC           AGCUUUC 
                  CG GC  CUCGCA   CC  AGA  CUAACUUGUGA       \
                  GC CG  GAGCGU   GG  UCU  GAUUGAGCGCU       U
AGAAGUAAGCUGCCGUUA  U^ AG      CUC  GU   AA           AGAAAAA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cte-Mir-10-P3_5p

MirBase accessionMIMAT0009525
Sequence
0- UCCCUGAGACCCUAACUUGUGA -22
Get sequence
Star sequence

Cte-Mir-10-P3_3p*

MirBase accessionNone
Sequence
39- GCGAGUUAGAAUCUUGGGCUCU -61
Get sequence