MirGeneDB

MirGeneDB ID

Rno-Mir-10-P3c

Family name MIR-10 (all species)
Seed CCCUGAG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-125b-2
Paralogues Rno-Mir-10-P1a-v1  Rno-Mir-10-P1a-v2  Rno-Mir-10-P1b-v1  Rno-Mir-10-P1b-v2  Rno-Mir-10-P2a  Rno-Mir-10-P2b  Rno-Mir-10-P2c  Rno-Mir-10-P3a  Rno-Mir-10-P3b 
Orthologues Aae-Mir-10-P3  Aca-Mir-10-P3c  Ami-Mir-10-P3c  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Bta-Mir-10-P3c  Cfa-Mir-10-P3c  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cli-Mir-10-P3c  Cpi-Mir-10-P3c  Cpo-Mir-10-P3c  Cte-Mir-10-P3  Dan-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dno-Mir-10-P3c  Dpu-Mir-10-P3  Dre-Mir-10-P3c1  Dre-Mir-10-P3c2  Ete-Mir-10-P3c  Gga-Mir-10-P3c  Hsa-Mir-10-P3c  Isc-Mir-10-P3  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mdo-Mir-10-P3c  Mml-Mir-10-P3c  Mmu-Mir-10-P3c  Oan-Mir-10-P3c  Ocu-Mir-10-P3c  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Sha-Mir-10-P3c  Sko-Mir-10-P3  Spu-Mir-10-P3  Sto-Mir-10-P3c  Tca-Mir-10-P3  Tgu-Mir-10-P3c  Xtr-Mir-10-P3c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(rn6)
chr11: 16097362-16097422 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCUCCUGCAUCAAACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUAUUUUAGUAACAUCACAAGUCAGGCUCUUGGGACCUAGGCGGAGAGGUACCAGCAGCUUUGGACCU
Get precursor sequence
Structure
        10        20          30        40        50          
UUCUCCUGCAUCAAACCAGA--|  UU     UC  UG   C   A        GGUAUUU 
                      CUU  CCUAG  CC  AGA CCU ACUUGUGA       \
                      GAG  GGAUC  GG  UCU GGA UGAACACU       U
UCCAGGUUUCGACGACCAUGGA^  GC     CA  GU   C   C        ACAAUGA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-10-P3c_5p

MirBase accessionMIMAT0000830
Sequence
0- UCCCUGAGACCCUAACUUGUGA -22
Get sequence
Validated targets microrna.org: MIMAT0000830
TargetScanVert: rno-miR-125b-5p
miRDB: MIMAT0000830
Star sequence

Rno-Mir-10-P3c_3p*

MirBase accessionMIMAT0026467
Sequence
39- ACAAGUCAGGCUCUUGGGACCU -61
Get sequence
Validated targets TargetScanVert: rno-miR-125b-2-3p
miRDB: MIMAT0026467