MirGeneDB

MirGeneDB ID

Isc-Mir-10-P3

Family name MIR-10 (all species)
Seed CCCUGAG
Species Deer tick (Ixodes scapularis)
MiRBase ID
Paralogues Isc-Mir-10-P1-v1  Isc-Mir-10-P1-v2  Isc-Mir-10-P2  Isc-Mir-10-P4 
Orthologues Aae-Mir-10-P3  Aca-Mir-10-P3a  Aca-Mir-10-P3b  Aca-Mir-10-P3c  Ami-Mir-10-P3a  Ami-Mir-10-P3b  Ami-Mir-10-P3c  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Bta-Mir-10-P3a  Bta-Mir-10-P3b  Bta-Mir-10-P3c  Cbr-Mir-10-P3e  Cbr-Mir-10-P3f  Cel-Mir-10-P3e  Cel-Mir-10-P3f  Cfa-Mir-10-P3a  Cfa-Mir-10-P3b  Cfa-Mir-10-P3c  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cli-Mir-10-P3a  Cli-Mir-10-P3c  Cpi-Mir-10-P3a  Cpi-Mir-10-P3b  Cpi-Mir-10-P3c  Cpo-Mir-10-P3a  Cpo-Mir-10-P3b  Cpo-Mir-10-P3c  Cte-Mir-10-P3  Dan-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dno-Mir-10-P3a  Dno-Mir-10-P3c  Dpu-Mir-10-P3  Dre-Mir-10-P3a1  Dre-Mir-10-P3a2  Dre-Mir-10-P3b1  Dre-Mir-10-P3b2  Dre-Mir-10-P3c1  Dre-Mir-10-P3c2  Efe-Mir-10-P3g  Efe-Mir-10-P3h  Efe-Mir-10-P3i  Ete-Mir-10-P3a  Ete-Mir-10-P3b  Ete-Mir-10-P3c  Gga-Mir-10-P3a  Gga-Mir-10-P3c  Hsa-Mir-10-P3a  Hsa-Mir-10-P3b  Hsa-Mir-10-P3c  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mdo-Mir-10-P3a  Mdo-Mir-10-P3c  Mml-Mir-10-P3a  Mml-Mir-10-P3b  Mml-Mir-10-P3c  Mmu-Mir-10-P3a  Mmu-Mir-10-P3b  Mmu-Mir-10-P3c  Oan-Mir-10-P3a  Oan-Mir-10-P3b  Oan-Mir-10-P3c  Ocu-Mir-10-P3a  Ocu-Mir-10-P3b  Ocu-Mir-10-P3c  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Rno-Mir-10-P3a  Rno-Mir-10-P3b  Rno-Mir-10-P3c  Sha-Mir-10-P3a  Sha-Mir-10-P3b  Sha-Mir-10-P3c  Sko-Mir-10-P3  Spu-Mir-10-P3  Sto-Mir-10-P3a  Sto-Mir-10-P3b  Sto-Mir-10-P3c  Tca-Mir-10-P3  Tgu-Mir-10-P3a  Tgu-Mir-10-P3c  Xtr-Mir-10-P3a  Xtr-Mir-10-P3b  Xtr-Mir-10-P3c 
Node of Origin (locus) Bilateria
Node of Origin (family) Eumetazoa
Genome context
(IscaWI)
DS978597: 217030-217092 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCUCCGAGUGGCAGCGGCCCUGUUCCCCACUCCCUGAGACCCUAACUUGUGAUGCGUUCUGCGCCGCCUUCCCAGGUUAGAUUCUCAGGCCCUGGGUAACAGUUUGGAGAGCGCAGCGACGGG
Get precursor sequence
Structure
        10          20        30        40        50        60 
GCUCCGAGUGGCAGCGGCC--|    C    CUC       CC        U  UGCGUUCU 
                     CUGUU CCCA   CCUGAGA  CUAACUUG GA        \
                     GACAA GGGU   GGACUCU  GAUUGGAC CU        G
GGGCAGCGACGCGAGAGGUUU^    U    CCC       UA        C  UCCGCCGC 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-10-P3_5p

MirBase accessionNone
Sequence
0- UCCCUGAGACCCUAACUUGUGA -22
Get sequence
Star sequence

Isc-Mir-10-P3_3p*

MirBase accessionNone
Sequence
41- CCAGGUUAGAUUCUCAGGCCCU -63
Get sequence