MirGeneDB

MirGeneDB ID

Spu-Mir-10-P3

Family name MIR-10 (all species)
Seed CCCUGAG
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-125
Paralogues Spu-Mir-10-P1  Spu-Mir-10-P2e  Spu-Mir-10-P2f 
Orthologues Aae-Mir-10-P3  Aca-Mir-10-P3a  Aca-Mir-10-P3b  Aca-Mir-10-P3c  Ami-Mir-10-P3a  Ami-Mir-10-P3b  Ami-Mir-10-P3c  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Bta-Mir-10-P3a  Bta-Mir-10-P3b  Bta-Mir-10-P3c  Cbr-Mir-10-P3e  Cbr-Mir-10-P3f  Cel-Mir-10-P3e  Cel-Mir-10-P3f  Cfa-Mir-10-P3a  Cfa-Mir-10-P3b  Cfa-Mir-10-P3c  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cli-Mir-10-P3a  Cli-Mir-10-P3c  Cpi-Mir-10-P3a  Cpi-Mir-10-P3b  Cpi-Mir-10-P3c  Cpo-Mir-10-P3a  Cpo-Mir-10-P3b  Cpo-Mir-10-P3c  Cte-Mir-10-P3  Dan-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dno-Mir-10-P3a  Dno-Mir-10-P3c  Dpu-Mir-10-P3  Dre-Mir-10-P3a1  Dre-Mir-10-P3a2  Dre-Mir-10-P3b1  Dre-Mir-10-P3b2  Dre-Mir-10-P3c1  Dre-Mir-10-P3c2  Efe-Mir-10-P3g  Efe-Mir-10-P3h  Efe-Mir-10-P3i  Ete-Mir-10-P3a  Ete-Mir-10-P3b  Ete-Mir-10-P3c  Gga-Mir-10-P3a  Gga-Mir-10-P3c  Hsa-Mir-10-P3a  Hsa-Mir-10-P3b  Hsa-Mir-10-P3c  Isc-Mir-10-P3  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mdo-Mir-10-P3a  Mdo-Mir-10-P3c  Mml-Mir-10-P3a  Mml-Mir-10-P3b  Mml-Mir-10-P3c  Mmu-Mir-10-P3a  Mmu-Mir-10-P3b  Mmu-Mir-10-P3c  Oan-Mir-10-P3a  Oan-Mir-10-P3b  Oan-Mir-10-P3c  Ocu-Mir-10-P3a  Ocu-Mir-10-P3b  Ocu-Mir-10-P3c  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Rno-Mir-10-P3a  Rno-Mir-10-P3b  Rno-Mir-10-P3c  Sha-Mir-10-P3a  Sha-Mir-10-P3b  Sha-Mir-10-P3c  Sko-Mir-10-P3  Sto-Mir-10-P3a  Sto-Mir-10-P3b  Sto-Mir-10-P3c  Tca-Mir-10-P3  Tgu-Mir-10-P3a  Tgu-Mir-10-P3c  Xtr-Mir-10-P3a  Xtr-Mir-10-P3b  Xtr-Mir-10-P3c 
Node of Origin (locus) Bilateria
Node of Origin (family) Eumetazoa
Genome context
(Spur_3.1)
Scaffold22: 1040532-1040594 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P3)
Mir-10-P3 Scaffold22: 1040532-1040594 [-] Ensembl
Let-7 Scaffold22: 1041492-1041559 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CAGAAAAAAAAAGAGAGACUGCCCCCCAAAUCCCUGAGACCCUAACUUGUGAUGUGCUUUUAUCAAAUCACACAGGUUGGUAUCUCAGGAAUUUGGUGGGCGUGUCAUGCCAACGAUCUCACU
Get precursor sequence
Structure
        10          20        30        40        50        60 
CAGAAAAAAAAAGAGAG-  -|    C      C       CC          AUGUGCUUU 
                  AC UGCCC CCAAAU CCUGAGA  CUAACUUGUG         \
                  UG GCGGG GGUUUA GGACUCU  GGUUGGACAC         U
UCACUCUAGCAACCGUAC  U^    U      A       AU          ACUAAACUA 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-10-P3_5p

MirBase accessionMIMAT0009667
Sequence
0- UCCCUGAGACCCUAACUUGUGA -22
Get sequence
Star sequence

Spu-Mir-10-P3_3p*

MirBase accessionMIMAT0019161
Sequence
41- ACAGGUUGGUAUCUCAGGAAUU -63
Get sequence