MirGeneDB

MirGeneDB ID

Dan-Mir-10-P3

Family name MIR-10 (all species)
Seed CCCUGAG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-125
Paralogues Dan-Mir-10-P1  Dan-Mir-10-P2  Dan-Mir-10-P4 
Orthologues Aae-Mir-10-P3  Aca-Mir-10-P3a  Aca-Mir-10-P3b  Aca-Mir-10-P3c  Ami-Mir-10-P3a  Ami-Mir-10-P3b  Ami-Mir-10-P3c  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Bta-Mir-10-P3a  Bta-Mir-10-P3b  Bta-Mir-10-P3c  Cbr-Mir-10-P3e  Cbr-Mir-10-P3f  Cel-Mir-10-P3e  Cel-Mir-10-P3f  Cfa-Mir-10-P3a  Cfa-Mir-10-P3b  Cfa-Mir-10-P3c  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cli-Mir-10-P3a  Cli-Mir-10-P3c  Cpi-Mir-10-P3a  Cpi-Mir-10-P3b  Cpi-Mir-10-P3c  Cpo-Mir-10-P3a  Cpo-Mir-10-P3b  Cpo-Mir-10-P3c  Cte-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dno-Mir-10-P3a  Dno-Mir-10-P3c  Dpu-Mir-10-P3  Dre-Mir-10-P3a1  Dre-Mir-10-P3a2  Dre-Mir-10-P3b1  Dre-Mir-10-P3b2  Dre-Mir-10-P3c1  Dre-Mir-10-P3c2  Efe-Mir-10-P3g  Efe-Mir-10-P3h  Efe-Mir-10-P3i  Ete-Mir-10-P3a  Ete-Mir-10-P3b  Ete-Mir-10-P3c  Gga-Mir-10-P3a  Gga-Mir-10-P3c  Hsa-Mir-10-P3a  Hsa-Mir-10-P3b  Hsa-Mir-10-P3c  Isc-Mir-10-P3  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mdo-Mir-10-P3a  Mdo-Mir-10-P3c  Mml-Mir-10-P3a  Mml-Mir-10-P3b  Mml-Mir-10-P3c  Mmu-Mir-10-P3a  Mmu-Mir-10-P3b  Mmu-Mir-10-P3c  Oan-Mir-10-P3a  Oan-Mir-10-P3b  Oan-Mir-10-P3c  Ocu-Mir-10-P3a  Ocu-Mir-10-P3b  Ocu-Mir-10-P3c  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Rno-Mir-10-P3a  Rno-Mir-10-P3b  Rno-Mir-10-P3c  Sha-Mir-10-P3a  Sha-Mir-10-P3b  Sha-Mir-10-P3c  Sko-Mir-10-P3  Spu-Mir-10-P3  Sto-Mir-10-P3a  Sto-Mir-10-P3b  Sto-Mir-10-P3c  Tca-Mir-10-P3  Tgu-Mir-10-P3a  Tgu-Mir-10-P3c  Xtr-Mir-10-P3a  Xtr-Mir-10-P3b  Xtr-Mir-10-P3c 
Node of Origin (locus) Bilateria
Node of Origin (family) Eumetazoa
Genome context
(Dana_caf1)
scaffold_12916: 2379504-2379563 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P3)
Mir-10-P2 scaffold_12916: 2378782-2378842 [+] Ensembl
Let-7 scaffold_12916: 2379191-2379250 [+] Ensembl
Mir-10-P3 scaffold_12916: 2379504-2379563 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUGACAUGUGCAAAUGUUUGUAUGGCUGAUUCCCUGAGACCCUAACUUGUGACUUUUAAUACCAGUUUCACAAGUUUUGAUCUCCGGUAUUGGACGCAAACUUGCUGAUGUUAAUACAAA
Get precursor sequence
Structure
        10            20        30        40        50          
GUGACAUGUGCAAAUGU----|   AUGG UG  UC  U    CCCU         CUUUUAA 
                     UUGU    C  AU  CC GAGA    AACUUGUGA       \
                     AACG    G  UA  GG CUCU    UUGAACACU       U
AAACAUAAUUGUAGUCGUUCA^   CA-- GU  U-  C    AGUU         UUGACCA 
.       110       100          90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Mature sequence

Dan-Mir-10-P3_5p

MirBase accessionMIMAT0008473
Sequence
0- UCCCUGAGACCCUAACUUGUGA -22
Get sequence
Star sequence

Dan-Mir-10-P3_3p*

MirBase accessionNone
Sequence
39- ACAAGUUUUGAUCUCCGGUAU -60
Get sequence