MirGeneDB

MirGeneDB ID

Dan-Mir-10-P1

Family name MIR-10 (all species)
Seed CCCUGUA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-10
Paralogues Dan-Mir-10-P2  Dan-Mir-10-P3  Dan-Mir-10-P4 
Orthologues Aae-Mir-10-P1-v1  Aae-Mir-10-P1-v2  Aca-Mir-10-P1a-v1  Aca-Mir-10-P1a-v2  Aca-Mir-10-P1b-v1  Aca-Mir-10-P1b-v2  Aca-Mir-10-P1c-v1  Aca-Mir-10-P1c-v2  Ami-Mir-10-P1a-v1  Ami-Mir-10-P1a-v2  Ami-Mir-10-P1b-v1  Ami-Mir-10-P1b-v2  Ami-Mir-10-P1c-v1  Ami-Mir-10-P1c-v2  Asu-Mir-10-P1  Bfl-Mir-10-P1-v1  Bfl-Mir-10-P1-v2  Bge-Mir-10-P1-v1  Bge-Mir-10-P1-v2  Bta-Mir-10-P1a-v1  Bta-Mir-10-P1a-v2  Bta-Mir-10-P1b-v1  Bta-Mir-10-P1b-v2  Cbr-Mir-10-P1  Cel-Mir-10-P1  Cfa-Mir-10-P1a-v1  Cfa-Mir-10-P1a-v2  Cfa-Mir-10-P1b-v1  Cfa-Mir-10-P1b-v2  Cgi-Mir-10-P1  Cli-Mir-10-P1a-v1  Cli-Mir-10-P1a-v2  Cli-Mir-10-P1b-v1  Cli-Mir-10-P1b-v2  Cli-Mir-10-P1c-v1  Cli-Mir-10-P1c-v2  Cpi-Mir-10-P1a-v1  Cpi-Mir-10-P1a-v2  Cpi-Mir-10-P1b-v1  Cpi-Mir-10-P1b-v2  Cpi-Mir-10-P1c-v1  Cpi-Mir-10-P1c-v2  Cpo-Mir-10-P1a-v1  Cpo-Mir-10-P1a-v2  Cpo-Mir-10-P1b-v1  Cpo-Mir-10-P1b-v2  Cte-Mir-10-P1  Dme-Mir-10-P1  Dmo-Mir-10-P1  Dno-Mir-10-P1a-v1  Dno-Mir-10-P1a-v2  Dno-Mir-10-P1b-v1  Dno-Mir-10-P1b-v2  Dpu-Mir-10-P1-v1  Dpu-Mir-10-P1-v2  Dre-Mir-10-P1a1-v1  Dre-Mir-10-P1a1-v2  Dre-Mir-10-P1a2-v1  Dre-Mir-10-P1a2-v2  Dre-Mir-10-P1b1-v1  Dre-Mir-10-P1b1-v2  Dre-Mir-10-P1b2-v1  Dre-Mir-10-P1b2-v2  Dre-Mir-10-P1c-v1  Dre-Mir-10-P1c-v2  Efe-Mir-10-P1e  Efe-Mir-10-P1f  Ete-Mir-10-P1a-v1  Ete-Mir-10-P1a-v2  Ete-Mir-10-P1b-v1  Ete-Mir-10-P1b-v2  Gga-Mir-10-P1a-v1  Gga-Mir-10-P1a-v2  Gga-Mir-10-P1b-v1  Gga-Mir-10-P1b-v2  Hme-Mir-10-P1-v1  Hme-Mir-10-P1-v2  Hsa-Mir-10-P1a-v1  Hsa-Mir-10-P1a-v2  Hsa-Mir-10-P1b-v1  Hsa-Mir-10-P1b-v2  Isc-Mir-10-P1-v1  Isc-Mir-10-P1-v2  Lan-Mir-10-P1g  Lan-Mir-10-P1h  Lgi-Mir-10-P1  Mdo-Mir-10-P1a-v1  Mdo-Mir-10-P1a-v2  Mdo-Mir-10-P1b-v1  Mdo-Mir-10-P1b-v2  Mml-Mir-10-P1a-v1  Mml-Mir-10-P1a-v2  Mml-Mir-10-P1b-v1  Mml-Mir-10-P1b-v2  Mmu-Mir-10-P1a-v1  Mmu-Mir-10-P1a-v2  Mmu-Mir-10-P1b-v1  Mmu-Mir-10-P1b-v2  Oan-Mir-10-P1a-v1  Oan-Mir-10-P1a-v2  Oan-Mir-10-P1b-v1  Oan-Mir-10-P1b-v2  Ocu-Mir-10-P1a-v1  Ocu-Mir-10-P1a-v2  Ocu-Mir-10-P1b-v1  Ocu-Mir-10-P1b-v2  Pfl-Mir-10-P1  Pmi-Mir-10-P1  Rno-Mir-10-P1a-v1  Rno-Mir-10-P1a-v2  Rno-Mir-10-P1b-v1  Rno-Mir-10-P1b-v2  Sha-Mir-10-P1a-v1  Sha-Mir-10-P1a-v2  Sha-Mir-10-P1b-v1  Sha-Mir-10-P1b-v2  Sko-Mir-10-P1  Spu-Mir-10-P1  Sto-Mir-10-P1a-v1  Sto-Mir-10-P1a-v2  Sto-Mir-10-P1b-v1  Sto-Mir-10-P1b-v2  Tca-Mir-10-P1-v1  Tca-Mir-10-P1-v2  Tgu-Mir-10-P1a-v1  Tgu-Mir-10-P1a-v2  Tgu-Mir-10-P1b-v1  Tgu-Mir-10-P1b-v2  Xtr-Mir-10-P1a-v1  Xtr-Mir-10-P1a-v2  Xtr-Mir-10-P1b-v1  Xtr-Mir-10-P1b-v2  Xtr-Mir-10-P1c-v1  Xtr-Mir-10-P1c-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Eumetazoa
Genome context
(Dana_caf1)
scaffold_13340: 5417376-5417438 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CUGUGCUCCUAUCCAGUUUGCUCCACGUCUACCCUGUAGAUCCGAAUUUGUUUUAUACUAGUUUUAAGGACAAAUUCGGUUCUAGAGAGGUUUGUGUGGUUCAAUUUCCAUCGUAAAAUAAAA
Get precursor sequence
Structure
        10          20        30         40        50        60
CUGUGCUCCUAUCCAGU--   CU     UCU   -| G    U           UUAUACU 
                   UUG  CCACG   ACC CU UAGA CCGAAUUUGUU       A
                   AAC  GGUGU   UGG GA AUCU GGCUUAAACAG       G
AAAAUAAAAUGCUACCUUU   UU     GUU   A^ G    U           GAAUUUU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-10-P1_5p

MirBase accessionMIMAT0008476
Sequence
0- ACCCUGUAGAUCCGAAUUUGUU -22
Get sequence
Star sequence

Dan-Mir-10-P1_3p*

MirBase accessionNone
Sequence
40- CAAAUUCGGUUCUAGAGAGGUUU -63
Get sequence