MirGeneDB

MirGeneDB ID

Dan-Mir-10-P4

Family name MIR-10 (all species)
Seed AAGCUCG
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Mir-10-P1  Dan-Mir-10-P2  Dan-Mir-10-P3 
Orthologues Aae-Mir-10-P4  Asu-Mir-10-P4  Bge-Mir-10-P4  Cte-Mir-10-P4  Dme-Mir-10-P4  Dmo-Mir-10-P4  Dpu-Mir-10-P4  Efe-Mir-10-P4a  Efe-Mir-10-P4b  Efe-Mir-10-P4c  Hme-Mir-10-P4  Isc-Mir-10-P4  Lan-Mir-10-P4a  Lan-Mir-10-P4b  Tca-Mir-10-P4 
Node of Origin (locus) Protostomia
Node of Origin (family) Eumetazoa
Genome context
(Dana_caf1)
scaffold_13340: 5446749-5446840 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACGAUCUUCAAUUGAAACGCUCCCGUGACCUACCCUGUAGUUCCGGGCUUUUGUUUAUAUUGCGUUCGAUGCAUUGUCGGACUGCUGGCUCGAUUAUCAGAAGCUCGUCUCUACAGGUAUCUCACAGGGUAGAAAGAAACAACAUUUCGAAG
Get precursor sequence
Structure
        10         20          30        40        50        60        70     
ACGAUCUUCAAUUGAAACG-  -   -|   CC    C     UUC          UUUAUAUUGCGUUCGAUGCAU 
                    CU CCC GUGA  UACC UGUAG   CGGGCUUUUG                     U
                    GA GGG CACU  AUGG ACAUC   GCUCGAAGAC                     G
GAAGCUUUACAACAAAGAAA  U   A^   CU    -     UCU          UAUUAGCUCGGUCGUCAGGCU 
150       140       130       120        110       100        90        80
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha site -1 on the 5p arm relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-10-P4_5p*

MirBase accessionNone
Sequence
0- UACCCUGUAGUUCCGGGCUUUUG -23
Get sequence
Mature sequence

Dan-Mir-10-P4_3p

MirBase accessionNone
Sequence
69- GAAGCUCGUCUCUACAGGUAUCU -92
Get sequence