MirGeneDB

MirGeneDB ID

Dan-Mir-10-P2

Family name MIR-10 (all species)
Seed ACCCGUA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-100
Paralogues Dan-Mir-10-P1  Dan-Mir-10-P3  Dan-Mir-10-P4 
Orthologues Aae-Mir-10-P2  Aca-Mir-10-P2a  Aca-Mir-10-P2b  Aca-Mir-10-P2c  Ami-Mir-10-P2a  Ami-Mir-10-P2b  Ami-Mir-10-P2c  Asu-Mir-10-P2o1  Asu-Mir-10-P2o2  Asu-Mir-10-P2o3  Asu-Mir-10-P2o4  Asu-Mir-10-P2o5  Asu-Mir-10-P2o6  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Bta-Mir-10-P2a  Bta-Mir-10-P2b  Bta-Mir-10-P2c  Cbr-Mir-10-P2l  Cel-Mir-10-P2l  Cfa-Mir-10-P2a  Cfa-Mir-10-P2b  Cfa-Mir-10-P2c  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cli-Mir-10-P2a  Cli-Mir-10-P2c  Cpi-Mir-10-P2a  Cpi-Mir-10-P2b  Cpi-Mir-10-P2c  Cpo-Mir-10-P2a  Cpo-Mir-10-P2b  Cpo-Mir-10-P2c  Cte-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dno-Mir-10-P2a  Dno-Mir-10-P2c  Dpu-Mir-10-P2  Dre-Mir-10-P2a1  Dre-Mir-10-P2a2  Dre-Mir-10-P2c1  Dre-Mir-10-P2c2  Efe-Mir-10-P2g  Efe-Mir-10-P2h  Efe-Mir-10-P2i  Efe-Mir-10-P2j  Efe-Mir-10-P2k  Ete-Mir-10-P2a  Ete-Mir-10-P2b  Ete-Mir-10-P2c  Gga-Mir-10-P2a  Gga-Mir-10-P2c  Hsa-Mir-10-P2a  Hsa-Mir-10-P2b  Hsa-Mir-10-P2c  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Mdo-Mir-10-P2a  Mml-Mir-10-P2a  Mml-Mir-10-P2b  Mml-Mir-10-P2c  Mmu-Mir-10-P2a  Mmu-Mir-10-P2b  Mmu-Mir-10-P2c  Oan-Mir-10-P2a  Oan-Mir-10-P2b  Oan-Mir-10-P2c  Ocu-Mir-10-P2a  Ocu-Mir-10-P2c  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Rno-Mir-10-P2a  Rno-Mir-10-P2b  Rno-Mir-10-P2c  Sha-Mir-10-P2a  Sha-Mir-10-P2b  Sha-Mir-10-P2c  Sko-Mir-10-P2  Spu-Mir-10-P2e  Spu-Mir-10-P2f  Sto-Mir-10-P2a  Sto-Mir-10-P2b  Sto-Mir-10-P2c  Tca-Mir-10-P2  Tgu-Mir-10-P2a3  Tgu-Mir-10-P2a4  Tgu-Mir-10-P2c3  Tgu-Mir-10-P2c4  Xtr-Mir-10-P2b  Xtr-Mir-10-P2c 
Node of Origin (locus) Bilateria
Node of Origin (family) Eumetazoa
Genome context
(Dana_caf1)
scaffold_12916: 2378782-2378842 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P2)
Mir-10-P2 scaffold_12916: 2378782-2378842 [+] Ensembl
Let-7 scaffold_12916: 2379191-2379250 [+] Ensembl
Mir-10-P3 scaffold_12916: 2379504-2379563 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUGCAUACUCACAUAUGGACCAUUAACAGAAACCCGUAAAUCCGAACUUGUGCUGUUUUUUAUCUGUUACAAGACCGGCAUUAUGGGAGUCUGUCAAUGCAAACAACUGGUUUUUGGCAAC
Get precursor sequence
Structure
        10        20          30        40        50          
GUGCAUACUCACAUAUGGAC--|   A     AA       AU   AA      CUGUUUU 
                      CAUU ACAGA  CCCGUAA  CCG  CUUGUG       \
                      GUAA UGUCU  GGGUAUU  GGC  GAACAU       U
CAACGGUUUUUGGUCAACAAAC^   C     GA       AC   CA      UGUCUAU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Mature sequence

Dan-Mir-10-P2_5p

MirBase accessionMIMAT0008478
Sequence
0- AACCCGUAAAUCCGAACUUGUG -22
Get sequence
Star sequence

Dan-Mir-10-P2_3p*

MirBase accessionNone
Sequence
39- CAAGACCGGCAUUAUGGGAGUC -61
Get sequence