MirGeneDB

MirGeneDB ID

Bta-Mir-10-P2c

Family name MIR-10 (all species)
Seed ACCCGUA
Species Cow (Bos taurus)
MiRBase ID bta-mir-99a
Paralogues Bta-Mir-10-P1a-v1  Bta-Mir-10-P1a-v2  Bta-Mir-10-P1b-v1  Bta-Mir-10-P1b-v2  Bta-Mir-10-P2a  Bta-Mir-10-P2b  Bta-Mir-10-P3a  Bta-Mir-10-P3b  Bta-Mir-10-P3c 
Orthologues Aae-Mir-10-P2  Aca-Mir-10-P2c  Ami-Mir-10-P2c  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Cfa-Mir-10-P2c  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cli-Mir-10-P2c  Cpi-Mir-10-P2c  Cpo-Mir-10-P2c  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dno-Mir-10-P2c  Dpu-Mir-10-P2  Dre-Mir-10-P2c1  Dre-Mir-10-P2c2  Ete-Mir-10-P2c  Gga-Mir-10-P2c  Hsa-Mir-10-P2c  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Mml-Mir-10-P2c  Mmu-Mir-10-P2c  Oan-Mir-10-P2c  Ocu-Mir-10-P2c  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Rno-Mir-10-P2c  Sha-Mir-10-P2c  Sko-Mir-10-P2  Sto-Mir-10-P2c  Tca-Mir-10-P2  Tgu-Mir-10-P2c3  Tgu-Mir-10-P2c4  Xtr-Mir-10-P2c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(bosTau8)
chr1: 19931194-19931253 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P2c)
Let-7-P1c chr1: 19930466-19930532 [-] UCSC Ensembl
Mir-10-P2c chr1: 19931194-19931253 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCCCACGUGAGACGUUGCCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGACCGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUGGUAAUCUGACAAAAUGCAAUA
Get precursor sequence
Structure
        10          20         30        40        50         
AGCCCACGUGAGACGUU--   -|         A         UC   U      GUGAAG 
                   GCC CAUUGGCAUA ACCCGUAGA  CGA CUUGUG      \
                   UGG GUGACUGUGU UGGGUAUCU  GCU GAACAC      U
AUAACGUAAAACAGUCUAA   U^         C         UC   C      GCCAGG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-10-P2c_5p

MirBase accessionMIMAT0003537
Sequence
0- AACCCGUAGAUCCGAUCUUGUG -22
Get sequence
Validated targets TargetScanVert: bta-miR-99a-5p
Star sequence

Bta-Mir-10-P2c_3p*

MirBase accessionMIMAT0012533
Sequence
37- CAAGCUCGCUUCUAUGGGUCUGU -60
Get sequence
Validated targets TargetScanVert: bta-miR-99a-3p