MirGeneDB

MirGeneDB ID

Bta-Let-7-P1c

Family name LET-7 (all species)
Seed GAGGUAG
Species Cow (Bos taurus)
MiRBase ID bta-let-7c
Paralogues Bta-Let-7-P1a  Bta-Let-7-P1b  Bta-Let-7-P2a1  Bta-Let-7-P2a2  Bta-Let-7-P2a3  Bta-Let-7-P2b1  Bta-Let-7-P2b2  Bta-Let-7-P2b3  Bta-Let-7-P2c1  Bta-Let-7-P2c2  Bta-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P1c  Ami-Let-7-P1c  Bge-Let-7  Cfa-Let-7-P1c  Cgi-Let-7  Cin-Let-7-P1  Cli-Let-7-P1c  Cpi-Let-7-P1c  Cpo-Let-7-P1c  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P1c  Dpu-Let-7  Dre-Let-7-P1c1  Dre-Let-7-P1c2  Ete-Let-7-P1c  Gga-Let-7-P1c  Hme-Let-7  Hsa-Let-7-P1c  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mml-Let-7-P1c  Mmu-Let-7-P1c  Oan-Let-7-P1c  Ocu-Let-7-P1c  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P1c  Sha-Let-7-P1c  Sko-Let-7  Spu-Let-7  Sto-Let-7-P1c  Tca-Let-7  Tgu-Let-7-P1c3  Tgu-Let-7-P1c4  Xtr-Let-7-P1c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr1: 19930466-19930532 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P1c)
Let-7-P1c chr1: 19930466-19930532 [-] UCSC Ensembl
Mir-10-P2c chr1: 19931194-19931253 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCAACACUGGAAGCUGUGUGCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCACACUUGAGCCAUCGAGGAAUUC
Get precursor sequence
Structure
        10           20        30        40        50        60   
AGCAACACUGGAAGCUG---|    A      UU   G   U             UAGAGUUACA 
                    UGUGC UCCGGG  GAG UAG AGGUUGUAUGGUU          \
                    ACACG AGGUUC  UUC AUC UCCAACAUGUCAA          C
CUUAAGGAGCUACCGAGUUC^    -      CU   G   U             UUGAGGGUCC 
     120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Let-7-P1c_5p

MirBase accessionMIMAT0004332
Sequence
0- UGAGGUAGUAGGUUGUAUGGUU -22
Get sequence
Validated targets TargetScanVert: bta-let-7c
Star sequence

Bta-Let-7-P1c_3p*

MirBase accessionNone
Sequence
45- CUGUACAACCUUCUAGCUUUCC -67
Get sequence