MirGeneDB

MirGeneDB ID

Cli-Mir-10-P2c

Family name MIR-10 (all species)
Seed ACCCGUA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-99
Paralogues Cli-Mir-10-P1a-v1  Cli-Mir-10-P1a-v2  Cli-Mir-10-P1b-v1  Cli-Mir-10-P1b-v2  Cli-Mir-10-P1c-v1  Cli-Mir-10-P1c-v2  Cli-Mir-10-P2a  Cli-Mir-10-P3a  Cli-Mir-10-P3c 
Orthologues Aae-Mir-10-P2  Aca-Mir-10-P2c  Ami-Mir-10-P2c  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Bta-Mir-10-P2c  Cfa-Mir-10-P2c  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cpi-Mir-10-P2c  Cpo-Mir-10-P2c  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dno-Mir-10-P2c  Dpu-Mir-10-P2  Dre-Mir-10-P2c1  Dre-Mir-10-P2c2  Ete-Mir-10-P2c  Gga-Mir-10-P2c  Hsa-Mir-10-P2c  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Mml-Mir-10-P2c  Mmu-Mir-10-P2c  Oan-Mir-10-P2c  Ocu-Mir-10-P2c  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Rno-Mir-10-P2c  Sha-Mir-10-P2c  Sko-Mir-10-P2  Sto-Mir-10-P2c  Tca-Mir-10-P2  Tgu-Mir-10-P2c3  Tgu-Mir-10-P2c4  Xtr-Mir-10-P2c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(colLiv2)
scaffold101: 18429914-18429973 [+]
Clustered MiRNAs
(< 10kb from Mir-10-P2c)
Mir-10-P2c scaffold101: 18429914-18429973 [+]
Let-7-P1c scaffold101: 18430669-18430735 [+]
Precursor
(pre-Mir +30nt flank)
AAAUGCUAAUCAACGAUGCCAAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGUUGAAACGCACUGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUAUGGUGAUCUGGCAAAAGUGUAUG
Get precursor sequence
Structure
        10          20         30        40        50         
AAAUGCUAAUCAACGAU--    -|        A         UC   U      UUGAAA 
                   GCCA AUUGGCAUA ACCCGUAGA  CGA CUUGUG      \
                   UGGU UGACUGUGU UGGGUAUCU  GCU GAACAC      C
GUAUGUGAAAACGGUCUAG    A^        C         UC   C      GUCACG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Mature sequence

Cli-Mir-10-P2c_5p

MirBase accessionMIMAT0038478
Sequence
0- AACCCGUAGAUCCGAUCUUGUG -22
Get sequence
Star sequence

Cli-Mir-10-P2c_3p*

MirBase accessionMIMAT0038479
Sequence
37- CAAGCUCGCUUCUAUGGGUCUGU -60
Get sequence