MirGeneDB

MirGeneDB ID

Sto-Mir-10-P2b

Family name MIR-10 (all species)
Seed ACCCGUA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-10-P1a-v1  Sto-Mir-10-P1a-v2  Sto-Mir-10-P1b-v1  Sto-Mir-10-P1b-v2  Sto-Mir-10-P2a  Sto-Mir-10-P2c  Sto-Mir-10-P3a  Sto-Mir-10-P3b  Sto-Mir-10-P3c 
Orthologues Aae-Mir-10-P2  Aca-Mir-10-P2b  Ami-Mir-10-P2b  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Bta-Mir-10-P2b  Cfa-Mir-10-P2b  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cpi-Mir-10-P2b  Cpo-Mir-10-P2b  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dpu-Mir-10-P2  Ete-Mir-10-P2b  Hsa-Mir-10-P2b  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Mml-Mir-10-P2b  Mmu-Mir-10-P2b  Oan-Mir-10-P2b  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Rno-Mir-10-P2b  Sha-Mir-10-P2b  Sko-Mir-10-P2  Tca-Mir-10-P2  Xtr-Mir-10-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(miRNA_loci_genome)
BFAA01007834.1: 17693-17751 [-]
Precursor
(pre-Mir +30nt flank)
UGCCUGCCCCUCAUUGGGCCAUUUGAGACUAACCCGUAGAUCCGAACUUGCGGUCGGACCAAUCACACAGGCUCGAGUCUGCGGGCCUGUCUCGGCAUGGCAACAACCACCAAAGGCGC
Get precursor sequence
Structure
        10         20         30        40        50         
UGCCUGCCCCUCAUUGG-     -|      UAA        UC   A    CGGUCGGA 
                  GCCAU UUGAGAC   CCCGUAGA  CGA CUUG        \
                  CGGUA GGCUCUG   GGGCGUCU  GCU GGAC        C
CGCGGAAACCACCAACAA     C^      UCC        GA   C    ACACUAAC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-10-P2b_5p

MirBase accessionNone
Sequence
0- AACCCGUAGAUCCGAACUUGCG -22
Get sequence
Star sequence

Sto-Mir-10-P2b_3p* (predicted)

MirBase accessionNone
Sequence
37- CAGGCUCGAGUCUGCGGGCCUG -59
Get sequence