MirGeneDB

MirGeneDB ID

Aca-Mir-10-P2b

Family name MIR-10 (all species)
Seed ACCCGUA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-99b
Paralogues Aca-Mir-10-P1a-v1  Aca-Mir-10-P1a-v2  Aca-Mir-10-P1b-v1  Aca-Mir-10-P1b-v2  Aca-Mir-10-P1c-v1  Aca-Mir-10-P1c-v2  Aca-Mir-10-P2a  Aca-Mir-10-P2c  Aca-Mir-10-P3a  Aca-Mir-10-P3b  Aca-Mir-10-P3c 
Orthologues Aae-Mir-10-P2  Ami-Mir-10-P2b  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Bta-Mir-10-P2b  Cfa-Mir-10-P2b  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cpi-Mir-10-P2b  Cpo-Mir-10-P2b  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dpu-Mir-10-P2  Ete-Mir-10-P2b  Hsa-Mir-10-P2b  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Mml-Mir-10-P2b  Mmu-Mir-10-P2b  Oan-Mir-10-P2b  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Rno-Mir-10-P2b  Sha-Mir-10-P2b  Sko-Mir-10-P2  Sto-Mir-10-P2b  Tca-Mir-10-P2  Xtr-Mir-10-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(anoCar2)
GL343604.1: 262460-262519 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P2b)
Mir-10-P2b GL343604.1: 262460-262519 [+] UCSC Ensembl
Let-7-P1b GL343604.1: 264168-264235 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCUGUUGUGUGGUUUUGCCAGUUGCCAUAAACCCGUAGAUCCGAACUUGCGGUACAACUGAUUCACACAAGCUCGAGUCUGUGGGUAUGUGUCGACCUCGGCCAAGGCGUCUGGACCCA
Get precursor sequence
Structure
        10        20          30        40        50         
CCCUGUUGUGUGGUUUUG  A--|   C    A         UC   A    CGGUACAA 
                  CC   GUUG CAUA ACCCGUAGA  CGA CUUG        C
                  GG   CAGC GUGU UGGGUGUCU  GCU GAAC        U
ACCCAGGUCUGCGGAACC  CUC^   U    A         GA   C    ACACUUAG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-10-P2b_5p

MirBase accessionMIMAT0021998
Sequence
0- AACCCGUAGAUCCGAACUUGCG -22
Get sequence
Star sequence

Aca-Mir-10-P2b_3p*

MirBase accessionMIMAT0021999
Sequence
38- CAAGCUCGAGUCUGUGGGUAUG -60
Get sequence