MirGeneDB ID | Ami-Let-7-P2c1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | LET-7 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | American alligator (Alligator mississippiensis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | ami-let-7d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Ami-Let-7-P1b Ami-Let-7-P1c Ami-Let-7-P1d Ami-Let-7-P2a1 Ami-Let-7-P2a2 Ami-Let-7-P2a3 Ami-Let-7-P2a4 Ami-Let-7-P2b1 Ami-Let-7-P2b2 Ami-Let-7-P2b3 Ami-Let-7-P2b4 Ami-Let-7-P2c2 Ami-Let-7-P2c3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Aae-Let-7 Aca-Let-7-P2c1 Aga-Let-7 Agr-Let-7 Bge-Let-7 Bko-Let-7 Bpl-Let-7 Bta-Let-7-P2c1 Cfa-Let-7-P2c1 Cja-Let-7-P2c1 Cli-Let-7-P2c1 Cmi-Let-7-P2c1 Cpi-Let-7-P2c1 Cpo-Let-7-P2c1 Cte-Let-7 Dan-Let-7 Dlo-Let-7 Dma-Let-7 Dme-Let-7 Dmo-Let-7 Dno-Let-7-P2c1 Dpu-Let-7 Dsi-Let-7 Dya-Let-7 Eba-Let-7 Eca-Let-7-P2c1 Egr-Let-7 Esc-Let-7 Ete-Let-7-P2c1 Gga-Let-7-P2c1 Gja-Let-7-P2c1 Gpa-Let-7 Gsa-Let-7 Gsp-Let-7 Hme-Let-7 Hmi-Let-7 Hru-Let-7 Hsa-Let-7-P2c1 Isc-Let-7 Laf-Let-7-P2c1 Lan-Let-7 Lch-Let-7-P2c1 Lgi-Let-7 Lhy-Let-7 Llo-Let-7 Loc-Let-7-P2c1 Mdo-Let-7-P2c1 Mgi-Let-7 Mml-Let-7-P2c1 Mmr-Let-7-P2c1 Mmu-Let-7-P2c1 Mom-Let-7 Mun-Let-7-P2c1 Neu-Let-7-P2c1 Npo-Let-7 Oan-Let-7-P2c1 Obi-Let-7 Ocu-Let-7-P2c1 Ofu-Let-7 Ovu-Let-7 Pab-Let-7-P2c1 Pau-Let-7 Pbv-Let-7-P2c1 Pca-Let-7 Pcr-Let-7 Pdu-Let-7 Pfl-Let-7 Ple-Let-7 Pmi-Let-7 Pve-Let-7 Rno-Let-7-P2c1 Rph-Let-7 Sha-Let-7-P2c1 Sko-Let-7 Sma-Let-7 Sne-Let-7 Snu-Let-7 Spt-Let-7-P2c1 Spu-Let-7 Sro-Let-7 Sto-Let-7-P2c1 Tca-Let-7 Tgu-Let-7-P2c1 Tur-Let-7 War-Let-7 Xbo-Let-7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCF_000281125.3_ASM28112v4_AMI_add) |
NW_017711902.1: 7300957-7301031 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Let-7-P2c1) |
Let-7-P2a1
NW_017711902.1: 7298633-7298704 [+]
UCSC
Let-7-P2b1 NW_017711902.1: 7299088-7299164 [+] UCSC Let-7-P2c1 NW_017711902.1: 7300957-7301031 [+] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | GAGGUAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
AACUGCAAAAGAAACAGUGGGCUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCUCACACGGAGUUAACUAUACAACCUGCUGCCUUUCUUAGGGCUUUAUUAUUACAACAGGACCAUUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 AACUGCAAAAGAAACAGU---| U A C UUAGGGCAGGGAUU GGGC CCUAGGA GAGGUAGUAGGUUG AUAGUU U UUCG GGAUUCU UUCCGUCGUCCAAC UAUCAA U UUACCAGGACAACAUUAUUAU^ - - A UUGAGGCACACUCG 130 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | This is a Group 2 in human according to Kim et al. (2017) but because there is a templated 3' U it is not possible according to read data to classify it as such in other taxa although the secondary structure is consistent with this categorization. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Ami-Let-7-P2c1_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | MIMAT0038008 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGAGGUAGUAGGUUGCAUAGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Ami-Let-7-P2c1_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | MIMAT0038009 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
54- CUAUACAACCUGCUGCCUUUC -75
Get sequence
|