MirGeneDB

MirGeneDB ID

Cli-Let-7-P2b1

Family name LET-7 (all species)
Seed GAGGUAG
Species Rock pigeon (Columba livia)
MiRBase ID cli-let-7f
Paralogues Cli-Let-7-P1a  Cli-Let-7-P1c  Cli-Let-7-P2a1  Cli-Let-7-P2a2  Cli-Let-7-P2a4  Cli-Let-7-P2b2  Cli-Let-7-P2b4  Cli-Let-7-P2c1  Cli-Let-7-P2c2  Cli-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P2b1  Ami-Let-7-P2b1  Bge-Let-7  Bta-Let-7-P2b1  Cfa-Let-7-P2b1  Cgi-Let-7  Cpi-Let-7-P2b1  Cpo-Let-7-P2b1  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2b1  Dpu-Let-7  Dre-Let-7-P2b1  Ete-Let-7-P2b1  Gga-Let-7-P2b1  Hme-Let-7  Hsa-Let-7-P2b1  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2b1  Mml-Let-7-P2b1  Mmu-Let-7-P2b1  Oan-Let-7-P2b1  Ocu-Let-7-P2b1  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2b1  Sha-Let-7-P2b1  Sko-Let-7  Spu-Let-7  Tca-Let-7  Tgu-Let-7-P2b1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold581: 22616-22692 [+]
Clustered MiRNAs
(< 10kb from Let-7-P2b1)
Let-7-P2a1 scaffold581: 22176-22247 [+]
Let-7-P2b1 scaffold581: 22616-22692 [+]
Let-7-P2c1 scaffold581: 23616-23690 [+]
Precursor
(pre-Mir +30nt flank)
UUUGCUGAAGUGUGUGCUUCUCUGUCAGAGUGAGGUAGUAGAUUGUAUAGUUGUAGGGUAGUUAUUUUACCCUGUUCAGGAGAUAACUAUACAAUCUAUUGCCUUCCCUGCGGAGUAAAACAAACUGCGGUGCUUUG
Get precursor sequence
Structure
        10           20        30        40        50        60        
UUUGCUGAAGUGUGUGCUU---|    U   AGU                     GUAGGGUAGUUAUUU 
                      CUCUG CAG   GAGGUAGUAGAUUGUAUAGUU               U
                      GAGGC GUC   UUCCGUUAUCUAACAUAUCAA               A
GUUUCGUGGCGUCAAACAAAAU^    -   CC-                     UAGAGGACUUGUCCC 
     130       120        110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Let-7-P2b1_5p

MirBase accessionMIMAT0038385
Sequence
0- UGAGGUAGUAGAUUGUAUAGUU -22
Get sequence
Star sequence

Cli-Let-7-P2b1_3p*

MirBase accessionMIMAT0038386
Sequence
56- CUAUACAAUCUAUUGCCUUCC -77
Get sequence