MirGeneDB

MirGeneDB ID

Cli-Let-7-P2a4

Family name LET-7 (all species)
Seed GAGGUAG
Species Rock pigeon (Columba livia)
MiRBase ID cli-let-7e
Paralogues Cli-Let-7-P1a  Cli-Let-7-P1c  Cli-Let-7-P2a1  Cli-Let-7-P2a2  Cli-Let-7-P2b1  Cli-Let-7-P2b2  Cli-Let-7-P2b4  Cli-Let-7-P2c1  Cli-Let-7-P2c2  Cli-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P2a4  Ami-Let-7-P2a4  Bge-Let-7  Cgi-Let-7  Cpi-Let-7-P2a4  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dpu-Let-7  Gga-Let-7-P2a4  Hme-Let-7  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Oan-Let-7-P2a4  Pfl-Let-7  Pmi-Let-7  Sko-Let-7  Spu-Let-7  Tca-Let-7  Tgu-Let-7-P2a4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold454: 1198025-1198095 [-]
Clustered MiRNAs
(< 10kb from Let-7-P2a4)
Let-7-P2b4 scaffold454: 1197815-1197892 [-]
Let-7-P2a4 scaffold454: 1198025-1198095 [-]
Precursor
(pre-Mir +30nt flank)
GCUGCCGCGAUCUCAAGCUGUCCUUGAGGCUGAGGUAGUAGAUUGAAUAGUUGUGGAGUCCGAUCCUCCCUUUGAGCAAACUAUACAAUCUACUGUCUUUCCUAAGGAGACAGUCAGGUCUUCAGUUCGCA
Get precursor sequence
Structure
        10         20         30        40        50        60     
GCUGCCGCGAUCUCAAG-     -|  G   CU   GU         A      GUGGAGUCCGAU 
                  CUGUC CUU AGG  GAG  AGUAGAUUG AUAGUU            C
                  GACAG GGA UCC  UUC  UCAUCUAAC UAUCAA            C
ACGCUUGACUUCUGGACU     A^  A   U-   UG         A      ACGAGUUUCCCU 
 .       120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUGUG in loop
Tissue expression
 +
To
Mature sequence

Cli-Let-7-P2a4_5p

MirBase accessionMIMAT0038383
Sequence
0- UGAGGUAGUAGAUUGAAUAGUU -22
Get sequence
Star sequence

Cli-Let-7-P2a4_3p*

MirBase accessionMIMAT0038384
Sequence
50- CUAUACAAUCUACUGUCUUUC -71
Get sequence