MirGeneDB

MirGeneDB ID

Mmu-Let-7-P2c3

Family name LET-7 (all species)
Seed GAGGUAG
Species House mouse (Mus musculus)
MiRBase ID mmu-let-7g
Paralogues Mmu-Let-7-P1a  Mmu-Let-7-P1b  Mmu-Let-7-P1c  Mmu-Let-7-P2a1  Mmu-Let-7-P2a2  Mmu-Let-7-P2a3  Mmu-Let-7-P2b1  Mmu-Let-7-P2b2  Mmu-Let-7-P2b3  Mmu-Let-7-P2c1  Mmu-Let-7-P2c2 
Orthologues Aae-Let-7  Aca-Let-7-P2c3  Ami-Let-7-P2c3  Bge-Let-7  Bta-Let-7-P2c3  Cfa-Let-7-P2c3  Cgi-Let-7  Cli-Let-7-P2c3  Cpi-Let-7-P2c3  Cpo-Let-7-P2c3  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2c3  Dpu-Let-7  Dre-Let-7-P2c3  Ete-Let-7-P2c3  Gga-Let-7-P2c3  Hme-Let-7  Hsa-Let-7-P2c3  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P2c3  Mml-Let-7-P2c3  Oan-Let-7-P2c3  Ocu-Let-7-P2c3  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2c3  Sha-Let-7-P2c3  Sko-Let-7  Spu-Let-7  Sto-Let-7-P2c3  Tca-Let-7  Xtr-Let-7-P2c3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr9: 106178846-106178923 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGCUCCGUUCUCUUUUGCCUGAUUCCAGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCAGGAACAGUGCACCAGCUACCAAAUGGGG
Get precursor sequence
Structure
        10           20        30        40        50        60         
CGCUCCGUUCUCUUUUGC---|  A    A   U        A            UGAGGGUCUAUGAUAC 
                     CUG UUCC GGC GAGGUAGU GUUUGUACAGUU                \
                     GAC AAGG CCG UUCCGUCA CGGACAUGUCAA                C
GGGGUAAACCAUCGACCACGU^  -    A   -        C            UAGAGGACAUGGCCCA 
      130       120        110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Let-7-P2c3_5p

MirBase accessionMIMAT0000121
Sequence
0- UGAGGUAGUAGUUUGUACAGUU -22
Get sequence
Validated targets microrna.org: MIMAT0000121
TargetScanVert: mmu-let-7g-5p
miRDB: MIMAT0000121
Star sequence

Mmu-Let-7-P2c3_3p*

MirBase accessionMIMAT0004519
Sequence
57- CUGUACAGGCCACUGCCUUGC -78
Get sequence
Validated targets microrna.org: MIMAT0004519
TargetScanVert: mmu-let-7g-3p
miRDB: MIMAT0004519