MirGeneDB

MirGeneDB ID

Mmu-Mir-135-P1

Family name MIR-135 (all species)
Seed AUGGCUU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-135a-1
Paralogues Mmu-Mir-135-P2  Mmu-Mir-135-P3 
Orthologues Aca-Mir-135-P1  Ami-Mir-135-P1  Bta-Mir-135-P1  Cfa-Mir-135-P1  Cli-Mir-135-P1  Cpi-Mir-135-P1  Cpo-Mir-135-P1  Dno-Mir-135-P1  Dre-Mir-135-P1  Ete-Mir-135-P1  Gga-Mir-135-P1a  Gga-Mir-135-P1b  Hsa-Mir-135-P1  Mml-Mir-135-P1  Oan-Mir-135-P1  Ocu-Mir-135-P1  Rno-Mir-135-P1  Sto-Mir-135-P1  Tgu-Mir-135-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Chordata
Genome context
(mm10)
chr9: 106154140-106154199 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAGGGGCCGCCCCAGGCCUCACUGUUCUCUAUGGCUUUUUAUUCCUAUGUGAUUCUAUUGCUCGCUCAUAUAGGGAUUGGAGCCGUGGCGUACGGUGAGGAUAAGCCAACAGAGGGCUC
Get precursor sequence
Structure
        10          20        30        40        50          
ACAGGGGCCGCCCCAGG--|        UCU          UU            UUCUAU 
                   CCUCACUGU   CUAUGGCUUU  AUUCCUAUGUGA      \
                   GGAGUGGCA   GGUGCCGAGG  UAGGGAUAUACU      U
CUCGGGAGACAACCGAAUA^        UGC          U-            CGCUCG 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-135-P1_5p

MirBase accessionMIMAT0000147
Sequence
0- UAUGGCUUUUUAUUCCUAUGUGA -23
Get sequence
Validated targets microrna.org: MIMAT0000147
TargetScanVert: mmu-miR-135a-5p
miRDB: MIMAT0000147
Star sequence

Mmu-Mir-135-P1_3p*

MirBase accessionMIMAT0004531
Sequence
38- AUAUAGGGAUUGGAGCCGUGGC -60
Get sequence
Validated targets microrna.org: MIMAT0004531
TargetScanVert: mmu-miR-135a-1-3p
miRDB: MIMAT0004531