MirGeneDB

MirGeneDB ID

Bta-Mir-135-P1

Family name MIR-135 (all species)
Seed AUGGCUU
Species Cow (Bos taurus)
MiRBase ID bta-mir-135a-1
Paralogues Bta-Mir-135-P2  Bta-Mir-135-P3 
Orthologues Aca-Mir-135-P1  Ami-Mir-135-P1  Cfa-Mir-135-P1  Cli-Mir-135-P1  Cpi-Mir-135-P1  Cpo-Mir-135-P1  Dno-Mir-135-P1  Dre-Mir-135-P1  Ete-Mir-135-P1  Gga-Mir-135-P1a  Gga-Mir-135-P1b  Hsa-Mir-135-P1  Mml-Mir-135-P1  Mmu-Mir-135-P1  Oan-Mir-135-P1  Ocu-Mir-135-P1  Rno-Mir-135-P1  Sto-Mir-135-P1  Tgu-Mir-135-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Chordata
Genome context
(bosTau8)
chr22: 49142044-49142103 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGGAGCAGCCCCAGGCCUCGCUGUUCUCUAUGGCUUUUUAUUCCUAUGUGAUUCUACUGCUCACUCAUAUAGGGAUUGGAGCCGUGGCGCACGGCGGGGGCAGCCAGCGGAGGGCUCG
Get precursor sequence
Structure
        10          20        30        40        50          
GCAGGAGCAGCCCCAGG--|        UCU          UU            UUCUAC 
                   CCUCGCUGU   CUAUGGCUUU  AUUCCUAUGUGA      \
                   GGGGCGGCA   GGUGCCGAGG  UAGGGAUAUACU      U
GCUCGGGAGGCGACCGACG^        CGC          U-            CACUCG 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-135-P1_5p

MirBase accessionMIMAT0009228
Sequence
0- UAUGGCUUUUUAUUCCUAUGUGA -23
Get sequence
Validated targets TargetScanVert: bta-miR-135a
Star sequence

Bta-Mir-135-P1_3p*

MirBase accessionNone
Sequence
38- AUAUAGGGAUUGGAGCCGUGGC -60
Get sequence