| MirGeneDB ID | Gja-Let-7-P2b3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | LET-7 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Let-7-P1b Gja-Let-7-P1c Gja-Let-7-P1d Gja-Let-7-P2a1 Gja-Let-7-P2a2 Gja-Let-7-P2a3 Gja-Let-7-P2a4 Gja-Let-7-P2b1 Gja-Let-7-P2b2 Gja-Let-7-P2b4 Gja-Let-7-P2c1 Gja-Let-7-P2c2 Gja-Let-7-P2c3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Let-7 Aca-Let-7-P2b3 Aga-Let-7 Agr-Let-7 Ami-Let-7-P2b3 Bge-Let-7 Bko-Let-7 Bpl-Let-7 Bta-Let-7-P2b3 Cfa-Let-7-P2b3 Cja-Let-7-P2b3 Cpi-Let-7-P2b3 Cpo-Let-7-P2b3 Cte-Let-7 Dan-Let-7 Dlo-Let-7 Dma-Let-7 Dme-Let-7 Dmo-Let-7 Dno-Let-7-P2b3 Dpu-Let-7 Dre-Let-7-P2b3a Dsi-Let-7 Dya-Let-7 Eba-Let-7 Eca-Let-7-P2b3 Egr-Let-7 Esc-Let-7 Ete-Let-7-P2b3 Gmo-Let-7-P2b3a Gmo-Let-7-P2b3b Gpa-Let-7 Gsa-Let-7 Gsp-Let-7 Hme-Let-7 Hmi-Let-7 Hru-Let-7 Hsa-Let-7-P2b3 Isc-Let-7 Laf-Let-7-P2b3 Lan-Let-7 Lgi-Let-7 Lhy-Let-7 Llo-Let-7 Loc-Let-7-P2b3 Mal-Let-7-P2b3a Mgi-Let-7 Mml-Let-7-P2b3 Mmr-Let-7-P2b3 Mmu-Let-7-P2b3 Mom-Let-7 Mun-Let-7-P2b3 Npo-Let-7 Oan-Let-7-P2b3 Obi-Let-7 Ocu-Let-7-P2b3 Ofu-Let-7 Ovu-Let-7 Pab-Let-7-P2b3 Pau-Let-7 Pbv-Let-7-P2b3 Pca-Let-7 Pcr-Let-7 Pdu-Let-7 Pfl-Let-7 Ple-Let-7 Pmi-Let-7 Pve-Let-7 Rno-Let-7-P2b3 Rph-Let-7 Sko-Let-7 Sma-Let-7 Sne-Let-7 Snu-Let-7 Spt-Let-7-P2b3 Spu-Let-7 Sro-Let-7 Sto-Let-7-P2b3 Tca-Let-7 Tni-Let-7-P2b3a Tni-Let-7-P2b3b Tur-Let-7 War-Let-7 Xbo-Let-7 Xla-Let-7-P2b3c Xla-Let-7-P2b3d Xtr-Let-7-P2b3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015173237.1: 128629-128706 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Let-7-P2b3) |
Let-7-P2a3
NW_015173237.1: 127969-128039 [+]
Let-7-P2b3 NW_015173237.1: 128629-128706 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAGGUAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GGGGAGGUGUCUCCGUUGCUCCUGCUGAGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUUUGUGCCCCAAAUCAGAGAUAACUAUACAACUUACUACUUUCCCCAGCUGGGGUGAAGUGCCCAGGAUUUGGGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GGGGAGGUGUCUCCGUU--| U A UG U GUGGGGUAGGGAUUUG GCUCC GCUG GG AGGUAGUAAGUUGUAU GUU \ UGGGG CGAC CC UUCAUCAUUCAACAUA CAA U GGGUUUAGGACCCGUGAAG^ U - CU U UAGAGACUAAACCCCG 130 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is likely a 1 nt mismatch at position 11 on the 5p arm between the source of the genome (G. japonicus) and the source of the reads (C. variegatus) accounting for the paucity of reads of the mature miRNA. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Let-7-P2b3_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGAGGUAGUAAGUUGUAUUGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Let-7-P2b3_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
57- CUAUACAACUUACUACUUUCC -78
Get sequence
|
