MirGeneDB

MirGeneDB ID

Oan-Let-7-P2b3

Family name LET-7 (all species)
Seed GAGGUAG
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-98
Paralogues Oan-Let-7-P1a  Oan-Let-7-P1b  Oan-Let-7-P1c  Oan-Let-7-P2a1  Oan-Let-7-P2a2  Oan-Let-7-P2a3  Oan-Let-7-P2a4  Oan-Let-7-P2b1  Oan-Let-7-P2b2  Oan-Let-7-P2b4  Oan-Let-7-P2c1  Oan-Let-7-P2c2  Oan-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P2b3  Ami-Let-7-P2b3  Bge-Let-7  Bta-Let-7-P2b3  Cfa-Let-7-P2b3  Cgi-Let-7  Cpi-Let-7-P2b3  Cpo-Let-7-P2b3  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P2b3  Dpu-Let-7  Ete-Let-7-P2b3  Hme-Let-7  Hsa-Let-7-P2b3  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mml-Let-7-P2b3  Mmu-Let-7-P2b3  Ocu-Let-7-P2b3  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P2b3  Sko-Let-7  Spu-Let-7  Tca-Let-7  Xtr-Let-7-P2b3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041733.1: 21207381-21207460 [+]
Clustered MiRNAs
(< 10kb from Let-7-P2b3)
Let-7-P2a3 NC_041733.1: 21206644-21206714 [+]
Let-7-P2b3 NC_041733.1: 21207381-21207460 [+]
Precursor
(pre-Mir +30nt flank)
UCGUAAGCUGUCAGUGUGCCCAUGCUGGGAUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUUUCUUUUGCCCCAAUUAGCGAUAACUAUACAAUUUACUACUUUCCCCAGUGUGUGGAACGAUCACUGGGUCCUAG
Get precursor sequence
Structure
        10         20         30        40        50        60          
UCGUAAGCUGUCAGUGUG-  -|        AU                 U   GUGGGGUAGGGAUUUCU 
                   CC CAUGCUGGG  GAGGUAGUAAGUUGUAU GUU                 \
                   GG GUGUGACCC  UUUCAUCAUUUAACAUA CAA                 U
GAUCCUGGGUCACUAGCAA  U^        C-                 U   UAGCGAUUAACCCCGUU 
.       130       120       110        100        90        80
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Br Ce He Ki Te
Mature sequence

Oan-Let-7-P2b3_5p

MirBase accessionMIMAT0007178
Sequence
0- UGAGGUAGUAAGUUGUAUUGUU -22
Get sequence
Star sequence

Oan-Let-7-P2b3_3p*

MirBase accessionNone
Sequence
59- CUAUACAAUUUACUACUUUCC -80
Get sequence