MirGeneDB

MirGeneDB ID

Cte-Mir-9

Family name MIR-9 (all species)
Seed CUUUGGU
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-mir-9
Paralogues
Orthologues Aae-Mir-9-P7a  Aae-Mir-9-P7b  Aae-Mir-9-P8  Aae-Mir-9-P9  Aae-Mir-9-P10-v1  Aae-Mir-9-P10-v2  Aca-Mir-9-P2  Aca-Mir-9-P3  Aca-Mir-9-P4  Ami-Mir-9-P1  Ami-Mir-9-P2  Ami-Mir-9-P3  Ami-Mir-9-P4  Asu-Mir-9-o17  Asu-Mir-9-o18-v1  Asu-Mir-9-o18-v2  Bfl-Mir-9-P5  Bfl-Mir-9-P6  Bge-Mir-9-o11  Bge-Mir-9-o12-v1  Bge-Mir-9-o12-v2  Bge-Mir-9-o13  Bge-Mir-9-o14  Bta-Mir-9-P1  Bta-Mir-9-P2  Bta-Mir-9-P3  Cbr-Mir-9-P17  Cbr-Mir-9-P18  Cbr-Mir-9-P19  Cel-Mir-9-P17  Cel-Mir-9-P18  Cel-Mir-9-P19  Cfa-Mir-9-P1  Cfa-Mir-9-P2  Cfa-Mir-9-P3  Cgi-Mir-9-P12  Cgi-Mir-9-P13  Cgi-Mir-9-P14  Cin-Mir-9  Cli-Mir-9-P1  Cli-Mir-9-P2  Cli-Mir-9-P4  Cpi-Mir-9-P1  Cpi-Mir-9-P2  Cpi-Mir-9-P3  Cpi-Mir-9-P4  Cpo-Mir-9-P1  Cpo-Mir-9-P2  Cpo-Mir-9-P3  Dan-Mir-9-P7  Dan-Mir-9-P8  Dan-Mir-9-P9  Dan-Mir-9-P10-v1  Dan-Mir-9-P10-v2  Dan-Mir-9-P11  Dme-Mir-9-P7  Dme-Mir-9-P8  Dme-Mir-9-P9  Dme-Mir-9-P10-v1  Dme-Mir-9-P10-v2  Dme-Mir-9-P11  Dmo-Mir-9-P7  Dmo-Mir-9-P8  Dmo-Mir-9-P9  Dmo-Mir-9-P10-v1  Dmo-Mir-9-P10-v2  Dmo-Mir-9-P11  Dno-Mir-9-P1  Dno-Mir-9-P2  Dno-Mir-9-P3  Dpu-Mir-9-o15  Dpu-Mir-9-o16  Dre-Mir-9-P1  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Dre-Mir-9-P3a  Dre-Mir-9-P3b  Dre-Mir-9-P4a  Dre-Mir-9-P4b  Efe-Mir-9-P15  Efe-Mir-9-P16  Ete-Mir-9-P1  Ete-Mir-9-P2  Ete-Mir-9-P3  Gga-Mir-9-P1  Gga-Mir-9-P2  Gga-Mir-9-P3  Gga-Mir-9-P4  Hme-Mir-9-o7  Hme-Mir-9-o8  Hme-Mir-9-o9  Hme-Mir-9-o10  Hsa-Mir-9-P1  Hsa-Mir-9-P2  Hsa-Mir-9-P3  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P1  Mdo-Mir-9-P2  Mdo-Mir-9-P3  Mdo-Mir-9-P4  Mml-Mir-9-P1  Mml-Mir-9-P2  Mml-Mir-9-P3  Mmu-Mir-9-P1  Mmu-Mir-9-P2  Mmu-Mir-9-P3  Oan-Mir-9-P1-v1  Oan-Mir-9-P1-v2  Oan-Mir-9-P2  Oan-Mir-9-P3  Oan-Mir-9-P4  Ocu-Mir-9-P1  Ocu-Mir-9-P2  Ocu-Mir-9-P3  Pfl-Mir-9-v1  Pfl-Mir-9-v2  Pmi-Mir-9  Rno-Mir-9-P1  Rno-Mir-9-P2  Rno-Mir-9-P3  Sha-Mir-9-P1  Sha-Mir-9-P2  Sha-Mir-9-P3  Sha-Mir-9-P4  Sko-Mir-9-v1  Sko-Mir-9-v2  Spu-Mir-9  Sto-Mir-9-P2  Sto-Mir-9-P3  Sto-Mir-9-P4  Tgu-Mir-9-P2  Tgu-Mir-9-P3  Xtr-Mir-9-P1  Xtr-Mir-9-P2  Xtr-Mir-9-P3  Xtr-Mir-9-P4 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Capitella_teleta_v1.0)
CAPTEscaffold_250: 129678-129738 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CGCUUCGUCUGCAUGAUAACCCCAUUUUUCUCUUUGGUUAUCUAGCUGUAUGAUUUAUAUUUUACUUCAUAAAGCUAGGUUACCAAAGCUAAAACAGGGGACAAAAUCUACCGAGUUACAU
Get precursor sequence
Structure
        10          20        30        40        50          
CGCUUCGUCUGCAUGAUAA--|   AU    CU       U        G     UUUAUA 
                     CCCC  UUUU  CUUUGGU AUCUAGCU UAUGA      \
                     GGGG  AAAA  GAAACCA UGGAUCGA AUACU      U
UACAUUGAGCCAUCUAAAACA^   AC    UC       U        A     UCAUUU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cte-Mir-9_5p

MirBase accessionMIMAT0009508
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Cte-Mir-9_3p* (predicted)

MirBase accessionMIMAT0009554
Sequence
38- AUAAAGCUAGGUUACCAAAGCUA -61
Get sequence