MirGeneDB

MirGeneDB ID

Hsa-Mir-9-P2

Family name MIR-9 (all species)
Seed CUUUGGU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-9-2
Paralogues Hsa-Mir-9-P1  Hsa-Mir-9-P3 
Orthologues Aca-Mir-9-P2  Ami-Mir-9-P2  Bta-Mir-9-P2  Cfa-Mir-9-P2  Cin-Mir-9  Cli-Mir-9-P2  Cpi-Mir-9-P2  Cpo-Mir-9-P2  Cte-Mir-9  Dno-Mir-9-P2  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Ete-Mir-9-P2  Gga-Mir-9-P2  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P2  Mml-Mir-9-P2  Mmu-Mir-9-P2  Oan-Mir-9-P2  Ocu-Mir-9-P2  Pmi-Mir-9  Rno-Mir-9-P2  Sha-Mir-9-P2  Spu-Mir-9  Sto-Mir-9-P2  Tgu-Mir-9-P2  Xtr-Mir-9-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(hg38)
chr5: 88666866-88666924 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAGAGGCCUGUGUGGGAAGCGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCAAGAUCGCCGGGGAGCGU
Get precursor sequence
Structure
        10          20        30        40        50         
ACAGAGGCCUGUGUGGG--|  C     G   UC               G     GUGUA 
                   AAG GAGUU UUA  UUUGGUUAUCUAGCU UAUGA     U
                   UUC CUCAA AAU  AAGCCAAUAGAUCGA AUACU     U
UGCGAGGGGCCGCUAGAAC^  -     A   GA               A     UCUGG 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-9-P2_5p

MirBase accessionMIMAT0000441
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Validated targets microrna.org: MIMAT0000441
TargetScanVert: hsa-miR-9-5p
TargetMiner: hsa-miR-9-5p
miRDB: MIMAT0000441
Star sequence

Hsa-Mir-9-P2_3p*

MirBase accessionMIMAT0000442
Sequence
37- AUAAAGCUAGAUAACCGAAAGU -59
Get sequence
Validated targets microrna.org: MIMAT0000442
TargetScanVert: hsa-miR-9-3p
TargetMiner: hsa-miR-9-3p
miRDB: MIMAT0000442