MirGeneDB

MirGeneDB ID

Mmu-Mir-9-P2

Family name MIR-9 (all species)
Seed CUUUGGU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-9-2
Paralogues Mmu-Mir-9-P1  Mmu-Mir-9-P3 
Orthologues Aca-Mir-9-P2  Ami-Mir-9-P2  Bta-Mir-9-P2  Cfa-Mir-9-P2  Cin-Mir-9  Cli-Mir-9-P2  Cpi-Mir-9-P2  Cpo-Mir-9-P2  Cte-Mir-9  Dno-Mir-9-P2  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Ete-Mir-9-P2  Gga-Mir-9-P2  Hsa-Mir-9-P2  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P2  Mml-Mir-9-P2  Oan-Mir-9-P2  Ocu-Mir-9-P2  Pmi-Mir-9  Rno-Mir-9-P2  Sha-Mir-9-P2  Spu-Mir-9  Sto-Mir-9-P2  Tgu-Mir-9-P2  Xtr-Mir-9-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr13: 83738821-83738879 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGCAGCCUUGUGAGGGAAGCGAGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGUAUUGGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAACUCCUUCAAGGUCACCGAGGAACGU
Get precursor sequence
Structure
        10          20        30        40        50         
AGGCAGCCUUGUGAGGG--|  C     G   UC               G     GUGUA 
                   AAG GAGUU UUA  UUUGGUUAUCUAGCU UAUGA     U
                   UUC CUCAA AAU  AAGCCAAUAGAUCGA AUACU     U
UGCAAGGAGCCACUGGAAC^  -     A   GA               A     UCUGG 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-9-P2_5p

MirBase accessionMIMAT0000142
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Validated targets microrna.org: MIMAT0000142
TargetScanVert: mmu-miR-9-5p
miRDB: MIMAT0000142
Star sequence

Mmu-Mir-9-P2_3p*

MirBase accessionMIMAT0000143
Sequence
37- AUAAAGCUAGAUAACCGAAAGU -59
Get sequence
Validated targets microrna.org: MIMAT0000143
TargetScanVert: mmu-miR-9-3p
miRDB: MIMAT0000143