
MirGeneDB ID


Family name MIR-9 (all species)
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-9-5
Paralogues Dre-Mir-9-P1  Dre-Mir-9-P2a  Dre-Mir-9-P3a  Dre-Mir-9-P3b  Dre-Mir-9-P4a  Dre-Mir-9-P4b 
Orthologues Aca-Mir-9-P2  Ami-Mir-9-P2  Bta-Mir-9-P2  Cfa-Mir-9-P2  Cin-Mir-9  Cli-Mir-9-P2  Cpi-Mir-9-P2  Cpo-Mir-9-P2  Cte-Mir-9  Dno-Mir-9-P2  Ete-Mir-9-P2  Gga-Mir-9-P2  Hsa-Mir-9-P2  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P2  Mml-Mir-9-P2  Mmu-Mir-9-P2  Oan-Mir-9-P2  Ocu-Mir-9-P2  Pmi-Mir-9  Rno-Mir-9-P2  Sha-Mir-9-P2  Spu-Mir-9  Sto-Mir-9-P2  Tgu-Mir-9-P2  Xtr-Mir-9-P2 
Node of Origin (locus) D. rerio
Node of Origin (family) Bilateria
Genome context
chr5: 48170110-48170169 [-] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40        50         
UACUGUUGUGGAAUUGGAA---| G    G   UC               G     GUAUU 
                      GC AGUU UUA  UUUGGUUAUCUAGCU UAUGA     U
                      CG UCAA AAU  AAGCCAAUAGAUCGA AUACU     U
GUCUCAAAGCUACUCGGUCCUC^ -    A   GA               A     UCACG 
.       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence


MirBase accessionMIMAT0001769
Get sequence
Validated targets TargetScanFish: dre-miR-9
Star sequence


MirBase accessionMIMAT0003156
Get sequence