MirGeneDB

MirGeneDB ID

Dre-Mir-9-P4b

Family name MIR-9 (all species)
Seed CUUUGGU
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-9-7
Paralogues Dre-Mir-9-P1  Dre-Mir-9-P2a  Dre-Mir-9-P2b  Dre-Mir-9-P3a  Dre-Mir-9-P3b  Dre-Mir-9-P4a 
Orthologues Aca-Mir-9-P4  Ami-Mir-9-P4  Cin-Mir-9  Cli-Mir-9-P4  Cpi-Mir-9-P4  Cte-Mir-9  Gga-Mir-9-P4  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Mdo-Mir-9-P4  Oan-Mir-9-P4  Pmi-Mir-9  Sha-Mir-9-P4  Spu-Mir-9  Sto-Mir-9-P4  Xtr-Mir-9-P4 
Node of Origin (locus) D. rerio
Node of Origin (family) Bilateria
Genome context
(danRer11)
chr2: 59102181-59102239 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCCCUUUAACGCGCACGGGUUAGUUUUUCUCUUUGGUUAUCUAGCUGUAUGAGUUAUGAAAUAUCAUAAAGCUAGAGAACCGAAAGUAGAAACUAUACCUACAGACUUCAUGACGCGC
Get precursor sequence
Structure
        10         20          30        40        50         
GCCCCUUUAACGCGCAC-    -        -| C       A       G     GUUAU 
                  GGGU UAGUUUUU CU UUUGGUU UCUAGCU UAUGA     \
                  UCCA AUCAAAGA GA AAGCCAA AGAUCGA AUACU     G
CGCGCAGUACUUCAGACA    U        U^ -       G       A     AUAAA 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-9-P4b_5p

MirBase accessionMIMAT0001769
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Validated targets TargetScanFish: dre-miR-9
Star sequence

Dre-Mir-9-P4b_3p*

MirBase accessionMIMAT0031933
Sequence
36- AUAAAGCUAGAGAACCGAAAGUA -59
Get sequence